Incidental Mutation 'R2915:Otulin'
ID 254865
Institutional Source Beutler Lab
Gene Symbol Otulin
Ensembl Gene ENSMUSG00000046034
Gene Name OTU deubiquitinase with linear linkage specificity
Synonyms m3Sapc, m7-1Sapc, Fam105b, gumby
MMRRC Submission 040502-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2915 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 27542635-27630693 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 27619630 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059662] [ENSMUST00000228439]
AlphaFold Q3UCV8
Predicted Effect probably benign
Transcript: ENSMUST00000059662
SMART Domains Protein: ENSMUSP00000057893
Gene: ENSMUSG00000046034

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
low complexity region 61 70 N/A INTRINSIC
Pfam:Peptidase_C101 80 344 4.7e-129 PFAM
Pfam:Peptidase_C65 96 344 1.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228439
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase C65 family of ubiquitin isopeptidases. Members of this family remove ubiquitin from proteins. The encoded enzyme specifically recognizes and removes M1(Met1)-linked, or linear, ubiquitin chains from protein substrates. Linear ubiquitin chains are known to regulate the NF-kappa B signaling pathway in the context of immunity and inflammation. Mutations in this gene cause a potentially fatal autoinflammatory syndrome in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Embryos homozygous for an ENU-induced mutation exhibit micrognathia, microcephaly, paucity of blood, and abnormal facial and vestibulocochlear nerve morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aif1 G A 17: 35,172,151 P44L probably benign Het
Arhgap11a A G 2: 113,833,508 V810A probably damaging Het
B3gnt6 T C 7: 98,193,593 N387D probably benign Het
Col5a2 C G 1: 45,413,496 G358R probably damaging Het
Cracr2a A G 6: 127,611,505 K209R probably damaging Het
Dmkn A G 7: 30,765,316 N32S unknown Het
Dusp13 T A 14: 21,740,137 N47I probably damaging Het
Elmo2 A G 2: 165,297,653 probably benign Het
Ephb6 T C 6: 41,614,238 F110L probably damaging Het
Gabrb2 T A 11: 42,591,907 N197K probably benign Het
Gdnf T A 15: 7,815,649 V41E possibly damaging Het
Gm21915 A G 9: 40,670,787 I59V possibly damaging Het
Gprin2 C T 14: 34,195,081 G244D possibly damaging Het
Grin2d T C 7: 45,833,357 probably benign Het
Ice2 A G 9: 69,410,840 D241G probably benign Het
Mios C T 6: 8,214,935 R44C possibly damaging Het
Nlrp5-ps T C 7: 14,586,711 noncoding transcript Het
Nyap2 C T 1: 81,087,471 R67* probably null Het
Olfr1031 T A 2: 85,992,045 V76E probably damaging Het
Olfr1094 T C 2: 86,829,226 I158T probably benign Het
Olfr1306 G T 2: 111,912,719 D70E probably damaging Het
Olfr1428 G A 19: 12,108,625 P81L probably benign Het
Olfr27 G T 9: 39,144,466 R122L possibly damaging Het
Otop2 G A 11: 115,329,146 A271T probably benign Het
Pax1 A G 2: 147,368,428 Y361C probably damaging Het
Pcdhb12 A T 18: 37,437,640 N613I probably damaging Het
Plekha5 A G 6: 140,589,199 K173E probably damaging Het
Plin4 T A 17: 56,104,389 T881S probably damaging Het
Poli A G 18: 70,522,700 probably null Het
Prex2 T A 1: 11,169,853 F898I probably damaging Het
Prr14l A T 5: 32,829,768 H794Q probably benign Het
Prss1 A T 6: 41,462,611 I93F probably benign Het
Ptpro C T 6: 137,414,241 probably benign Het
Rad1 T C 15: 10,486,642 C42R probably damaging Het
Rnf20 A G 4: 49,638,769 E197G probably benign Het
Setx A G 2: 29,172,324 E2260G probably damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Six2 A G 17: 85,685,188 S296P probably damaging Het
Smg1 T A 7: 118,210,879 probably benign Het
Spred2 T C 11: 19,998,215 V41A probably damaging Het
Ssu2 A T 6: 112,377,605 C219* probably null Het
Tbc1d9b T A 11: 50,149,736 V360D possibly damaging Het
Tdrd9 G A 12: 112,040,461 D920N probably damaging Het
Tyrp1 A G 4: 80,837,455 T154A possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Wac A C 18: 7,926,131 M596L possibly damaging Het
Zfhx2 G T 14: 55,064,557 P1990Q probably damaging Het
Zfp853 T C 5: 143,289,577 E96G unknown Het
Zzef1 G A 11: 72,910,326 probably null Het
Other mutations in Otulin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02121:Otulin APN 15 27608737 missense probably damaging 1.00
R0265:Otulin UTSW 15 27616424 missense probably damaging 1.00
R0363:Otulin UTSW 15 27606295 missense probably damaging 1.00
R0508:Otulin UTSW 15 27608858 missense possibly damaging 0.93
R6077:Otulin UTSW 15 27611610 missense probably benign 0.00
R7099:Otulin UTSW 15 27608746 missense probably damaging 1.00
R7145:Otulin UTSW 15 27608770 missense probably damaging 1.00
R7904:Otulin UTSW 15 27630494 missense probably benign 0.37
R8111:Otulin UTSW 15 27606295 missense probably damaging 1.00
R8319:Otulin UTSW 15 27606318 frame shift probably null
R8731:Otulin UTSW 15 27608842 missense probably benign 0.44
R9562:Otulin UTSW 15 27608726 missense probably damaging 1.00
X0013:Otulin UTSW 15 27606434 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGCATCCTATGATACGTAGCTC -3'
(R):5'- GGAGTTAATGAGCAACCTGACTGG -3'

Sequencing Primer
(F):5'- TCCTATGATACGTAGCTCAGGACAG -3'
(R):5'- GGAGACCCATTAAGAGAGCACTC -3'
Posted On 2014-12-29