Mutagenetix > Incidental Mutation

Incidental Mutation 'R2915:Aif1'

254866

Institutional Source

Beutler Lab

Gene Symbol

Aif1

Ensembl Gene

ENSMUSG00000024397

Gene Name

allograft inflammatory factor 1

Synonyms

D17H6S50E, Iba1, G1

MMRRC Submission

040502-MU

Accession Numbers

Genbank: NM_019467; MGI: 1343098

Essential gene?

Possibly non essential (E-score: 0.253) question?

Stock #

R2915 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

35170991-35176068 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 35172151 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 44 (P44L)

Ref Sequence

ENSEMBL: ENSMUSP00000134107 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025257] [ENSMUST00000172693] [ENSMUST00000173106] [ENSMUST00000173324]

AlphaFold

O70200

Predicted Effect

probably benign
Transcript: ENSMUST00000025257
AA Change: P44L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000025257
Gene: ENSMUSG00000024397
AA Change: P44L

Domain	Start	End	E-Value	Type
PDB:1WY9\|A	1	147	1e-104	PDB
SCOP:d1mr8a_	48	130	7e-10	SMART
Blast:EFh	49	77	1e-10	BLAST
Blast:EFh	85	113	1e-7	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172285

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172679

Predicted Effect

probably benign
Transcript: ENSMUST00000172693
AA Change: P44L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000134214
Gene: ENSMUSG00000024397
AA Change: P44L

Domain	Start	End	E-Value	Type
PDB:1WY9\|A	1	147	1e-104	PDB
SCOP:d1mr8a_	48	130	7e-10	SMART
Blast:EFh	49	77	1e-10	BLAST
Blast:EFh	85	113	1e-7	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000173106
AA Change: P44L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000134107
Gene: ENSMUSG00000024397
AA Change: P44L

Domain	Start	End	E-Value	Type
PDB:1WY9\|A	1	128	4e-47	PDB
Blast:EFh	98	122	4e-9	BLAST
SCOP:d1mr8a_	98	128	7e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173281

Predicted Effect

probably benign
Transcript: ENSMUST00000173324
AA Change: P44L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000133709
Gene: ENSMUSG00000024397
AA Change: P44L

Domain	Start	End	E-Value	Type
PDB:1WY9\|A	1	147	1e-104	PDB
SCOP:d1mr8a_	48	130	7e-10	SMART
Blast:EFh	49	77	1e-10	BLAST
Blast:EFh	85	113	1e-7	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174044

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds actin and calcium. This gene is induced by cytokines and interferon and may promote macrophage activation and growth of vascular smooth muscle cells and T-lymphocytes. Polymorphisms in this gene may be associated with systemic sclerosis. Alternative splicing results in multiple transcript variants, but the full-length and coding nature of some of these variants is not certain. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased spleen weight, decreased platalet cell number and decreased susceptibility to induced arthritis. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap11a	A	G	2: 113,833,508	V810A	probably damaging	Het
B3gnt6	T	C	7: 98,193,593	N387D	probably benign	Het
Col5a2	C	G	1: 45,413,496	G358R	probably damaging	Het
Cracr2a	A	G	6: 127,611,505	K209R	probably damaging	Het
Dmkn	A	G	7: 30,765,316	N32S	unknown	Het
Dusp13	T	A	14: 21,740,137	N47I	probably damaging	Het
Elmo2	A	G	2: 165,297,653		probably benign	Het
Ephb6	T	C	6: 41,614,238	F110L	probably damaging	Het
Gabrb2	T	A	11: 42,591,907	N197K	probably benign	Het
Gdnf	T	A	15: 7,815,649	V41E	possibly damaging	Het
Gm21915	A	G	9: 40,670,787	I59V	possibly damaging	Het
Gprin2	C	T	14: 34,195,081	G244D	possibly damaging	Het
Grin2d	T	C	7: 45,833,357		probably benign	Het
Ice2	A	G	9: 69,410,840	D241G	probably benign	Het
Mios	C	T	6: 8,214,935	R44C	possibly damaging	Het
Nlrp5-ps	T	C	7: 14,586,711		noncoding transcript	Het
Nyap2	C	T	1: 81,087,471	R67*	probably null	Het
Olfr1031	T	A	2: 85,992,045	V76E	probably damaging	Het
Olfr1094	T	C	2: 86,829,226	I158T	probably benign	Het
Olfr1306	G	T	2: 111,912,719	D70E	probably damaging	Het
Olfr1428	G	A	19: 12,108,625	P81L	probably benign	Het
Olfr27	G	T	9: 39,144,466	R122L	possibly damaging	Het
Otop2	G	A	11: 115,329,146	A271T	probably benign	Het
Otulin	A	G	15: 27,619,630		probably benign	Het
Pax1	A	G	2: 147,368,428	Y361C	probably damaging	Het
Pcdhb12	A	T	18: 37,437,640	N613I	probably damaging	Het
Plekha5	A	G	6: 140,589,199	K173E	probably damaging	Het
Plin4	T	A	17: 56,104,389	T881S	probably damaging	Het
Poli	A	G	18: 70,522,700		probably null	Het
Prex2	T	A	1: 11,169,853	F898I	probably damaging	Het
Prr14l	A	T	5: 32,829,768	H794Q	probably benign	Het
Prss1	A	T	6: 41,462,611	I93F	probably benign	Het
Ptpro	C	T	6: 137,414,241		probably benign	Het
Rad1	T	C	15: 10,486,642	C42R	probably damaging	Het
Rnf20	A	G	4: 49,638,769	E197G	probably benign	Het
Setx	A	G	2: 29,172,324	E2260G	probably damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Six2	A	G	17: 85,685,188	S296P	probably damaging	Het
Smg1	T	A	7: 118,210,879		probably benign	Het
Spred2	T	C	11: 19,998,215	V41A	probably damaging	Het
Ssu2	A	T	6: 112,377,605	C219*	probably null	Het
Tbc1d9b	T	A	11: 50,149,736	V360D	possibly damaging	Het
Tdrd9	G	A	12: 112,040,461	D920N	probably damaging	Het
Tyrp1	A	G	4: 80,837,455	T154A	possibly damaging	Het
Vrk3	C	T	7: 44,775,442	T427M	probably benign	Het
Wac	A	C	18: 7,926,131	M596L	possibly damaging	Het
Zfhx2	G	T	14: 55,064,557	P1990Q	probably damaging	Het
Zfp853	T	C	5: 143,289,577	E96G	unknown	Het
Zzef1	G	A	11: 72,910,326		probably null	Het

Other mutations in Aif1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01717:Aif1	APN	17	35171555	missense	probably damaging	1.00
IGL03279:Aif1	APN	17	35171547	nonsense	probably null
N/A:Aif1	UTSW	17	35172520	missense	possibly damaging	0.83
R0396:Aif1	UTSW	17	35171109	makesense	probably null
R1062:Aif1	UTSW	17	35172151	missense	probably benign	0.01
R1063:Aif1	UTSW	17	35172151	missense	probably benign	0.01
R1064:Aif1	UTSW	17	35172151	missense	probably benign	0.01
R1105:Aif1	UTSW	17	35172151	missense	probably benign	0.01
R1122:Aif1	UTSW	17	35172151	missense	probably benign	0.01
R1154:Aif1	UTSW	17	35172151	missense	probably benign	0.01
R1286:Aif1	UTSW	17	35172151	missense	probably benign	0.01
R1447:Aif1	UTSW	17	35172151	missense	probably benign	0.01
R1678:Aif1	UTSW	17	35172151	missense	probably benign	0.01
R1689:Aif1	UTSW	17	35172151	missense	probably benign	0.01
R1750:Aif1	UTSW	17	35172151	missense	probably benign	0.01
R1911:Aif1	UTSW	17	35172151	missense	probably benign	0.01
R1974:Aif1	UTSW	17	35172151	missense	probably benign	0.01
R2314:Aif1	UTSW	17	35172151	missense	probably benign	0.01
R2338:Aif1	UTSW	17	35172151	missense	probably benign	0.01
R2341:Aif1	UTSW	17	35172151	missense	probably benign	0.01
R4953:Aif1	UTSW	17	35171098	splice site	probably null
R5260:Aif1	UTSW	17	35171941	critical splice acceptor site	probably null
R6786:Aif1	UTSW	17	35171496	missense	probably damaging	1.00
R7503:Aif1	UTSW	17	35171573	missense	probably damaging	1.00
R7534:Aif1	UTSW	17	35171414	missense	possibly damaging	0.77
R7891:Aif1	UTSW	17	35172624	start gained	probably benign
R8075:Aif1	UTSW	17	35171835	missense	unknown
Y4338:Aif1	UTSW	17	35172151	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGTTGGTGGCTGAGCAATGC -3'
(R):5'- AGCTTTTGGACTGCTGAAGG -3'

Sequencing Primer
(F):5'- CTGAGCAATGCCAGGGTAG -3'
(R):5'- GACTGCTGAAGGCCCAG -3'

Posted On

2014-12-29