Incidental Mutation 'R2915:Aif1'
ID254866
Institutional Source Beutler Lab
Gene Symbol Aif1
Ensembl Gene ENSMUSG00000024397
Gene Nameallograft inflammatory factor 1
SynonymsD17H6S50E, Iba1, G1
MMRRC Submission 040502-MU
Accession Numbers

Genbank: NM_019467; MGI: 1343098

Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R2915 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35170991-35176068 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35172151 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 44 (P44L)
Ref Sequence ENSEMBL: ENSMUSP00000134107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025257] [ENSMUST00000172693] [ENSMUST00000173106] [ENSMUST00000173324]
Predicted Effect probably benign
Transcript: ENSMUST00000025257
AA Change: P44L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025257
Gene: ENSMUSG00000024397
AA Change: P44L

DomainStartEndE-ValueType
PDB:1WY9|A 1 147 1e-104 PDB
SCOP:d1mr8a_ 48 130 7e-10 SMART
Blast:EFh 49 77 1e-10 BLAST
Blast:EFh 85 113 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172679
Predicted Effect probably benign
Transcript: ENSMUST00000172693
AA Change: P44L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134214
Gene: ENSMUSG00000024397
AA Change: P44L

DomainStartEndE-ValueType
PDB:1WY9|A 1 147 1e-104 PDB
SCOP:d1mr8a_ 48 130 7e-10 SMART
Blast:EFh 49 77 1e-10 BLAST
Blast:EFh 85 113 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173106
AA Change: P44L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000134107
Gene: ENSMUSG00000024397
AA Change: P44L

DomainStartEndE-ValueType
PDB:1WY9|A 1 128 4e-47 PDB
Blast:EFh 98 122 4e-9 BLAST
SCOP:d1mr8a_ 98 128 7e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173281
Predicted Effect probably benign
Transcript: ENSMUST00000173324
AA Change: P44L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133709
Gene: ENSMUSG00000024397
AA Change: P44L

DomainStartEndE-ValueType
PDB:1WY9|A 1 147 1e-104 PDB
SCOP:d1mr8a_ 48 130 7e-10 SMART
Blast:EFh 49 77 1e-10 BLAST
Blast:EFh 85 113 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174044
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds actin and calcium. This gene is induced by cytokines and interferon and may promote macrophage activation and growth of vascular smooth muscle cells and T-lymphocytes. Polymorphisms in this gene may be associated with systemic sclerosis. Alternative splicing results in multiple transcript variants, but the full-length and coding nature of some of these variants is not certain. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased spleen weight, decreased platalet cell number and decreased susceptibility to induced arthritis. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap11a A G 2: 113,833,508 V810A probably damaging Het
B3gnt6 T C 7: 98,193,593 N387D probably benign Het
Col5a2 C G 1: 45,413,496 G358R probably damaging Het
Cracr2a A G 6: 127,611,505 K209R probably damaging Het
Dmkn A G 7: 30,765,316 N32S unknown Het
Dusp13 T A 14: 21,740,137 N47I probably damaging Het
Elmo2 A G 2: 165,297,653 probably benign Het
Ephb6 T C 6: 41,614,238 F110L probably damaging Het
Gabrb2 T A 11: 42,591,907 N197K probably benign Het
Gdnf T A 15: 7,815,649 V41E possibly damaging Het
Gm21915 A G 9: 40,670,787 I59V possibly damaging Het
Gprin2 C T 14: 34,195,081 G244D possibly damaging Het
Grin2d T C 7: 45,833,357 probably benign Het
Ice2 A G 9: 69,410,840 D241G probably benign Het
Mios C T 6: 8,214,935 R44C possibly damaging Het
Nlrp5-ps T C 7: 14,586,711 noncoding transcript Het
Nyap2 C T 1: 81,087,471 R67* probably null Het
Olfr1031 T A 2: 85,992,045 V76E probably damaging Het
Olfr1094 T C 2: 86,829,226 I158T probably benign Het
Olfr1306 G T 2: 111,912,719 D70E probably damaging Het
Olfr1428 G A 19: 12,108,625 P81L probably benign Het
Olfr27 G T 9: 39,144,466 R122L possibly damaging Het
Otop2 G A 11: 115,329,146 A271T probably benign Het
Otulin A G 15: 27,619,630 probably benign Het
Pax1 A G 2: 147,368,428 Y361C probably damaging Het
Pcdhb12 A T 18: 37,437,640 N613I probably damaging Het
Plekha5 A G 6: 140,589,199 K173E probably damaging Het
Plin4 T A 17: 56,104,389 T881S probably damaging Het
Poli A G 18: 70,522,700 probably null Het
Prex2 T A 1: 11,169,853 F898I probably damaging Het
Prr14l A T 5: 32,829,768 H794Q probably benign Het
Prss1 A T 6: 41,462,611 I93F probably benign Het
Ptpro C T 6: 137,414,241 probably benign Het
Rad1 T C 15: 10,486,642 C42R probably damaging Het
Rnf20 A G 4: 49,638,769 E197G probably benign Het
Setx A G 2: 29,172,324 E2260G probably damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Six2 A G 17: 85,685,188 S296P probably damaging Het
Smg1 T A 7: 118,210,879 probably benign Het
Spred2 T C 11: 19,998,215 V41A probably damaging Het
Ssu2 A T 6: 112,377,605 C219* probably null Het
Tbc1d9b T A 11: 50,149,736 V360D possibly damaging Het
Tdrd9 G A 12: 112,040,461 D920N probably damaging Het
Tyrp1 A G 4: 80,837,455 T154A possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Wac A C 18: 7,926,131 M596L possibly damaging Het
Zfhx2 G T 14: 55,064,557 P1990Q probably damaging Het
Zfp853 T C 5: 143,289,577 E96G unknown Het
Zzef1 G A 11: 72,910,326 probably null Het
Other mutations in Aif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01717:Aif1 APN 17 35171555 missense probably damaging 1.00
IGL03279:Aif1 APN 17 35171547 nonsense probably null
N/A:Aif1 UTSW 17 35172520 missense possibly damaging 0.83
R0396:Aif1 UTSW 17 35171109 makesense probably null
R1062:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1063:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1064:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1105:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1122:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1154:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1286:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1447:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1678:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1689:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1750:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1911:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1974:Aif1 UTSW 17 35172151 missense probably benign 0.01
R2314:Aif1 UTSW 17 35172151 missense probably benign 0.01
R2338:Aif1 UTSW 17 35172151 missense probably benign 0.01
R2341:Aif1 UTSW 17 35172151 missense probably benign 0.01
R4953:Aif1 UTSW 17 35171098 unclassified probably null
R5260:Aif1 UTSW 17 35171941 critical splice acceptor site probably null
R6786:Aif1 UTSW 17 35171496 missense probably damaging 1.00
R7503:Aif1 UTSW 17 35171573 missense probably damaging 1.00
R7534:Aif1 UTSW 17 35171414 missense possibly damaging 0.77
R7891:Aif1 UTSW 17 35172624 start gained probably benign
R7974:Aif1 UTSW 17 35172624 start gained probably benign
Y4338:Aif1 UTSW 17 35172151 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTTGGTGGCTGAGCAATGC -3'
(R):5'- AGCTTTTGGACTGCTGAAGG -3'

Sequencing Primer
(F):5'- CTGAGCAATGCCAGGGTAG -3'
(R):5'- GACTGCTGAAGGCCCAG -3'
Posted On2014-12-29