Incidental Mutation 'R2915:Plin4'
ID254867
Institutional Source Beutler Lab
Gene Symbol Plin4
Ensembl Gene ENSMUSG00000002831
Gene Nameperilipin 4
SynonymsS3-12
MMRRC Submission 040502-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R2915 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location56100591-56109803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56104389 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 881 (T881S)
Ref Sequence ENSEMBL: ENSMUSP00000139859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002908] [ENSMUST00000002911] [ENSMUST00000190703] [ENSMUST00000225843] [ENSMUST00000226053]
Predicted Effect probably damaging
Transcript: ENSMUST00000002908
AA Change: T881S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000002908
Gene: ENSMUSG00000002831
AA Change: T881S

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
internal_repeat_2 74 335 9.44e-7 PROSPERO
internal_repeat_1 103 467 2.72e-12 PROSPERO
internal_repeat_2 343 701 9.44e-7 PROSPERO
internal_repeat_1 598 1090 2.72e-12 PROSPERO
low complexity region 1124 1136 N/A INTRINSIC
Pfam:Perilipin 1144 1385 2.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000002911
SMART Domains Protein: ENSMUSP00000002911
Gene: ENSMUSG00000002833

DomainStartEndE-ValueType
PWWP 5 62 1.78e-19 SMART
low complexity region 90 109 N/A INTRINSIC
low complexity region 127 136 N/A INTRINSIC
low complexity region 137 153 N/A INTRINSIC
low complexity region 163 175 N/A INTRINSIC
low complexity region 181 196 N/A INTRINSIC
low complexity region 212 243 N/A INTRINSIC
low complexity region 252 272 N/A INTRINSIC
low complexity region 273 300 N/A INTRINSIC
low complexity region 301 311 N/A INTRINSIC
coiled coil region 321 364 N/A INTRINSIC
low complexity region 398 411 N/A INTRINSIC
Pfam:LEDGF 468 569 2.8e-31 PFAM
internal_repeat_1 575 644 2.5e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000190703
AA Change: T881S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139859
Gene: ENSMUSG00000002831
AA Change: T881S

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
internal_repeat_2 74 335 9.44e-7 PROSPERO
internal_repeat_1 103 467 2.72e-12 PROSPERO
internal_repeat_2 343 701 9.44e-7 PROSPERO
internal_repeat_1 598 1090 2.72e-12 PROSPERO
Pfam:Perilipin 1110 1385 1.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224701
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225731
Predicted Effect probably benign
Transcript: ENSMUST00000225843
Predicted Effect probably benign
Transcript: ENSMUST00000226053
Meta Mutation Damage Score 0.1552 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the perilipin family, such as PLIN4, coat intracellular lipid storage droplets (Wolins et al., 2003 [PubMed 12840023]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased triglyceride in the heart and protection from cardiac steatosis induced by prolonged fasting, feeding or genetic obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aif1 G A 17: 35,172,151 P44L probably benign Het
Arhgap11a A G 2: 113,833,508 V810A probably damaging Het
B3gnt6 T C 7: 98,193,593 N387D probably benign Het
Col5a2 C G 1: 45,413,496 G358R probably damaging Het
Cracr2a A G 6: 127,611,505 K209R probably damaging Het
Dmkn A G 7: 30,765,316 N32S unknown Het
Dusp13 T A 14: 21,740,137 N47I probably damaging Het
Elmo2 A G 2: 165,297,653 probably benign Het
Ephb6 T C 6: 41,614,238 F110L probably damaging Het
Gabrb2 T A 11: 42,591,907 N197K probably benign Het
Gdnf T A 15: 7,815,649 V41E possibly damaging Het
Gm21915 A G 9: 40,670,787 I59V possibly damaging Het
Gprin2 C T 14: 34,195,081 G244D possibly damaging Het
Grin2d T C 7: 45,833,357 probably benign Het
Ice2 A G 9: 69,410,840 D241G probably benign Het
Mios C T 6: 8,214,935 R44C possibly damaging Het
Nlrp5-ps T C 7: 14,586,711 noncoding transcript Het
Nyap2 C T 1: 81,087,471 R67* probably null Het
Olfr1031 T A 2: 85,992,045 V76E probably damaging Het
Olfr1094 T C 2: 86,829,226 I158T probably benign Het
Olfr1306 G T 2: 111,912,719 D70E probably damaging Het
Olfr1428 G A 19: 12,108,625 P81L probably benign Het
Olfr27 G T 9: 39,144,466 R122L possibly damaging Het
Otop2 G A 11: 115,329,146 A271T probably benign Het
Otulin A G 15: 27,619,630 probably benign Het
Pax1 A G 2: 147,368,428 Y361C probably damaging Het
Pcdhb12 A T 18: 37,437,640 N613I probably damaging Het
Plekha5 A G 6: 140,589,199 K173E probably damaging Het
Poli A G 18: 70,522,700 probably null Het
Prex2 T A 1: 11,169,853 F898I probably damaging Het
Prr14l A T 5: 32,829,768 H794Q probably benign Het
Prss1 A T 6: 41,462,611 I93F probably benign Het
Ptpro C T 6: 137,414,241 probably benign Het
Rad1 T C 15: 10,486,642 C42R probably damaging Het
Rnf20 A G 4: 49,638,769 E197G probably benign Het
Setx A G 2: 29,172,324 E2260G probably damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Six2 A G 17: 85,685,188 S296P probably damaging Het
Smg1 T A 7: 118,210,879 probably benign Het
Spred2 T C 11: 19,998,215 V41A probably damaging Het
Ssu2 A T 6: 112,377,605 C219* probably null Het
Tbc1d9b T A 11: 50,149,736 V360D possibly damaging Het
Tdrd9 G A 12: 112,040,461 D920N probably damaging Het
Tyrp1 A G 4: 80,837,455 T154A possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Wac A C 18: 7,926,131 M596L possibly damaging Het
Zfhx2 G T 14: 55,064,557 P1990Q probably damaging Het
Zfp853 T C 5: 143,289,577 E96G unknown Het
Zzef1 G A 11: 72,910,326 probably null Het
Other mutations in Plin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01685:Plin4 APN 17 56107362 missense probably damaging 0.98
IGL02121:Plin4 APN 17 56102131 missense probably damaging 0.98
IGL02254:Plin4 APN 17 56104733 missense probably damaging 0.98
IGL02539:Plin4 APN 17 56106680 missense probably damaging 1.00
IGL02892:Plin4 APN 17 56105108 missense probably damaging 1.00
IGL03051:Plin4 APN 17 56105417 missense possibly damaging 0.91
IGL03258:Plin4 APN 17 56104371 missense probably benign 0.05
PIT4519001:Plin4 UTSW 17 56103828 missense probably benign 0.23
R0211:Plin4 UTSW 17 56102242 missense probably damaging 1.00
R0365:Plin4 UTSW 17 56104667 missense possibly damaging 0.93
R0545:Plin4 UTSW 17 56106567 missense probably damaging 1.00
R0551:Plin4 UTSW 17 56106756 missense probably benign 0.03
R0862:Plin4 UTSW 17 56103966 missense probably benign 0.00
R0864:Plin4 UTSW 17 56103966 missense probably benign 0.00
R1260:Plin4 UTSW 17 56104348 nonsense probably null
R1650:Plin4 UTSW 17 56104931 missense probably damaging 0.99
R1688:Plin4 UTSW 17 56109363 missense possibly damaging 0.61
R1725:Plin4 UTSW 17 56106473 missense probably damaging 1.00
R1803:Plin4 UTSW 17 56104931 missense probably damaging 0.99
R1834:Plin4 UTSW 17 56103522 missense probably damaging 0.97
R1953:Plin4 UTSW 17 56103849 missense possibly damaging 0.49
R2860:Plin4 UTSW 17 56106668 missense probably damaging 0.98
R2861:Plin4 UTSW 17 56106668 missense probably damaging 0.98
R3438:Plin4 UTSW 17 56107193 missense probably benign 0.26
R3622:Plin4 UTSW 17 56104112 missense possibly damaging 0.92
R3932:Plin4 UTSW 17 56106704 missense probably benign 0.01
R4116:Plin4 UTSW 17 56102113 missense probably benign 0.30
R4201:Plin4 UTSW 17 56104338 missense probably damaging 1.00
R4529:Plin4 UTSW 17 56104274 missense probably damaging 1.00
R4610:Plin4 UTSW 17 56105418 missense probably benign 0.08
R4692:Plin4 UTSW 17 56103762 missense probably damaging 1.00
R4693:Plin4 UTSW 17 56103762 missense probably damaging 1.00
R4718:Plin4 UTSW 17 56106981 missense possibly damaging 0.46
R5283:Plin4 UTSW 17 56106777 missense probably benign 0.00
R5304:Plin4 UTSW 17 56106132 missense probably benign 0.00
R5333:Plin4 UTSW 17 56104970 missense probably benign 0.31
R5484:Plin4 UTSW 17 56104932 missense possibly damaging 0.90
R5569:Plin4 UTSW 17 56102147 missense probably benign 0.02
R5765:Plin4 UTSW 17 56102470 missense possibly damaging 0.68
R5776:Plin4 UTSW 17 56104983 missense probably damaging 0.99
R5828:Plin4 UTSW 17 56107064 missense probably damaging 0.99
R5932:Plin4 UTSW 17 56106356 missense possibly damaging 0.92
R5988:Plin4 UTSW 17 56109567 missense probably benign 0.03
R6053:Plin4 UTSW 17 56108618 missense probably benign 0.01
R6264:Plin4 UTSW 17 56104787 missense possibly damaging 0.90
R6334:Plin4 UTSW 17 56103261 missense probably benign 0.22
R6415:Plin4 UTSW 17 56103264 missense probably damaging 1.00
R7030:Plin4 UTSW 17 56103969 missense probably damaging 1.00
R7302:Plin4 UTSW 17 56102330 missense probably benign 0.00
R7342:Plin4 UTSW 17 56104608 missense probably benign 0.01
R7352:Plin4 UTSW 17 56104427 missense probably benign 0.16
R7354:Plin4 UTSW 17 56104427 missense probably benign 0.16
R7505:Plin4 UTSW 17 56109357 missense possibly damaging 0.56
R7540:Plin4 UTSW 17 56104883 missense probably damaging 0.96
R7570:Plin4 UTSW 17 56106776 missense probably benign 0.00
R7685:Plin4 UTSW 17 56102413 missense probably benign 0.02
R7699:Plin4 UTSW 17 56103828 missense probably benign 0.01
R8165:Plin4 UTSW 17 56107019 missense possibly damaging 0.92
R8309:Plin4 UTSW 17 56104437 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGACTTGGTGGTATCCAGGC -3'
(R):5'- GTCTGTGGTCATGGGCACTAAG -3'

Sequencing Primer
(F):5'- GTGGTATCCAGGCCTCCTTG -3'
(R):5'- TGGTCATGGGCACTAAGGACAC -3'
Posted On2014-12-29