Incidental Mutation 'R2915:Six2'
ID254868
Institutional Source Beutler Lab
Gene Symbol Six2
Ensembl Gene ENSMUSG00000024134
Gene Namesine oculis-related homeobox 2
Synonyms
MMRRC Submission 040502-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2915 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location85684277-85688274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85685188 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 296 (S296P)
Ref Sequence ENSEMBL: ENSMUSP00000125871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024947] [ENSMUST00000163568]
Predicted Effect probably damaging
Transcript: ENSMUST00000024947
AA Change: S296P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024947
Gene: ENSMUSG00000024134
AA Change: S296P

DomainStartEndE-ValueType
HOX 125 186 8.72e-18 SMART
low complexity region 228 269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163568
AA Change: S296P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125871
Gene: ENSMUSG00000024134
AA Change: S296P

DomainStartEndE-ValueType
Pfam:SIX1_SD 9 119 1.5e-52 PFAM
HOX 125 186 8.72e-18 SMART
low complexity region 228 269 N/A INTRINSIC
Meta Mutation Damage Score 0.1435 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the vertebrate gene family which encode proteins homologous to the Drosophila 'sine oculis' homeobox protein. The encoded protein is a transcription factor which, like other members of this gene family, may be involved in limb or eye development. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die shortly after birth and exhibit abnormal kidney development. Abnormalities include small kidney, lack of ureteric bud branches throughout the kidney, increased apoptosis and premature and arrested nephron development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aif1 G A 17: 35,172,151 P44L probably benign Het
Arhgap11a A G 2: 113,833,508 V810A probably damaging Het
B3gnt6 T C 7: 98,193,593 N387D probably benign Het
Col5a2 C G 1: 45,413,496 G358R probably damaging Het
Cracr2a A G 6: 127,611,505 K209R probably damaging Het
Dmkn A G 7: 30,765,316 N32S unknown Het
Dusp13 T A 14: 21,740,137 N47I probably damaging Het
Elmo2 A G 2: 165,297,653 probably benign Het
Ephb6 T C 6: 41,614,238 F110L probably damaging Het
Gabrb2 T A 11: 42,591,907 N197K probably benign Het
Gdnf T A 15: 7,815,649 V41E possibly damaging Het
Gm21915 A G 9: 40,670,787 I59V possibly damaging Het
Gprin2 C T 14: 34,195,081 G244D possibly damaging Het
Grin2d T C 7: 45,833,357 probably benign Het
Ice2 A G 9: 69,410,840 D241G probably benign Het
Mios C T 6: 8,214,935 R44C possibly damaging Het
Nlrp5-ps T C 7: 14,586,711 noncoding transcript Het
Nyap2 C T 1: 81,087,471 R67* probably null Het
Olfr1031 T A 2: 85,992,045 V76E probably damaging Het
Olfr1094 T C 2: 86,829,226 I158T probably benign Het
Olfr1306 G T 2: 111,912,719 D70E probably damaging Het
Olfr1428 G A 19: 12,108,625 P81L probably benign Het
Olfr27 G T 9: 39,144,466 R122L possibly damaging Het
Otop2 G A 11: 115,329,146 A271T probably benign Het
Otulin A G 15: 27,619,630 probably benign Het
Pax1 A G 2: 147,368,428 Y361C probably damaging Het
Pcdhb12 A T 18: 37,437,640 N613I probably damaging Het
Plekha5 A G 6: 140,589,199 K173E probably damaging Het
Plin4 T A 17: 56,104,389 T881S probably damaging Het
Poli A G 18: 70,522,700 probably null Het
Prex2 T A 1: 11,169,853 F898I probably damaging Het
Prr14l A T 5: 32,829,768 H794Q probably benign Het
Prss1 A T 6: 41,462,611 I93F probably benign Het
Ptpro C T 6: 137,414,241 probably benign Het
Rad1 T C 15: 10,486,642 C42R probably damaging Het
Rnf20 A G 4: 49,638,769 E197G probably benign Het
Setx A G 2: 29,172,324 E2260G probably damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Smg1 T A 7: 118,210,879 probably benign Het
Spred2 T C 11: 19,998,215 V41A probably damaging Het
Ssu2 A T 6: 112,377,605 C219* probably null Het
Tbc1d9b T A 11: 50,149,736 V360D possibly damaging Het
Tdrd9 G A 12: 112,040,461 D920N probably damaging Het
Tyrp1 A G 4: 80,837,455 T154A possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Wac A C 18: 7,926,131 M596L possibly damaging Het
Zfhx2 G T 14: 55,064,557 P1990Q probably damaging Het
Zfp853 T C 5: 143,289,577 E96G unknown Het
Zzef1 G A 11: 72,910,326 probably null Het
Other mutations in Six2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Six2 APN 17 85687891 missense probably damaging 1.00
IGL02452:Six2 APN 17 85685378 missense possibly damaging 0.91
IGL02468:Six2 APN 17 85685503 missense possibly damaging 0.80
PIT4449001:Six2 UTSW 17 85685478 missense probably benign 0.00
PIT4812001:Six2 UTSW 17 85685301 missense possibly damaging 0.92
R2073:Six2 UTSW 17 85687505 missense probably damaging 1.00
R2075:Six2 UTSW 17 85687505 missense probably damaging 1.00
R3830:Six2 UTSW 17 85685187 missense probably damaging 1.00
R5834:Six2 UTSW 17 85687664 missense probably damaging 0.96
R7555:Six2 UTSW 17 85687707 missense probably damaging 1.00
R7723:Six2 UTSW 17 85687675 missense probably benign 0.06
R8011:Six2 UTSW 17 85687672 missense probably damaging 1.00
Z1176:Six2 UTSW 17 85685456 missense probably benign 0.26
Z1177:Six2 UTSW 17 85687625 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGATACCGAGCAGACCATTG -3'
(R):5'- TTCCGAGGATGAGAAGACGC -3'

Sequencing Primer
(F):5'- GAGCAGACCATTGTCCACTTTG -3'
(R):5'- AGACCACTCGTCGTCCAGTC -3'
Posted On2014-12-29