Incidental Mutation 'R2915:Poli'
ID254871
Institutional Source Beutler Lab
Gene Symbol Poli
Ensembl Gene ENSMUSG00000038425
Gene Namepolymerase (DNA directed), iota
SynonymsRad30b
MMRRC Submission 040502-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2915 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location70508680-70530620 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 70522700 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043286] [ENSMUST00000121674] [ENSMUST00000159389] [ENSMUST00000160713] [ENSMUST00000161542]
Predicted Effect probably null
Transcript: ENSMUST00000043286
SMART Domains Protein: ENSMUSP00000039869
Gene: ENSMUSG00000038425

DomainStartEndE-ValueType
Pfam:IMS 1 168 5.4e-39 PFAM
Pfam:IMS_HHH 180 212 1.2e-9 PFAM
Pfam:IMS_C 247 379 1.7e-12 PFAM
PDB:2KWV|A 444 489 8e-23 PDB
low complexity region 532 546 N/A INTRINSIC
PDB:3AI4|A 623 674 4e-26 PDB
Predicted Effect probably null
Transcript: ENSMUST00000121674
SMART Domains Protein: ENSMUSP00000112563
Gene: ENSMUSG00000038425

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:IMS 53 231 1e-47 PFAM
Pfam:IMS_HHH 243 275 1.5e-9 PFAM
Pfam:IMS_C 312 441 2.5e-14 PFAM
PDB:2KWV|A 507 552 8e-23 PDB
low complexity region 595 609 N/A INTRINSIC
PDB:3AI4|A 686 737 5e-26 PDB
Predicted Effect probably null
Transcript: ENSMUST00000159389
SMART Domains Protein: ENSMUSP00000123964
Gene: ENSMUSG00000038425

DomainStartEndE-ValueType
Pfam:IMS 1 145 1.8e-29 PFAM
Pfam:IMS_HHH 157 189 1.7e-9 PFAM
Pfam:IMS_C 224 356 2.4e-12 PFAM
PDB:2KWV|A 421 466 7e-23 PDB
low complexity region 509 523 N/A INTRINSIC
PDB:3AI4|A 600 651 3e-26 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160713
SMART Domains Protein: ENSMUSP00000125467
Gene: ENSMUSG00000038425

DomainStartEndE-ValueType
Pfam:IMS 1 127 5.9e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161542
SMART Domains Protein: ENSMUSP00000124877
Gene: ENSMUSG00000038425

DomainStartEndE-ValueType
Pfam:IMS 1 168 5.4e-39 PFAM
Pfam:IMS_HHH 180 212 1.2e-9 PFAM
Pfam:IMS_C 247 379 1.7e-12 PFAM
PDB:2KWV|A 444 489 8e-23 PDB
low complexity region 532 546 N/A INTRINSIC
PDB:3AI4|A 623 674 4e-26 PDB
Meta Mutation Damage Score 0.9492 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous mutation show normal somatic hypermutation of immunoglobulin variable genes and no significant increase in UV-induced epithelial skin tumor formation relative to controls; in contrast, formation of mesenchymal tumors by chronic UV irradiation is enhanced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aif1 G A 17: 35,172,151 P44L probably benign Het
Arhgap11a A G 2: 113,833,508 V810A probably damaging Het
B3gnt6 T C 7: 98,193,593 N387D probably benign Het
Col5a2 C G 1: 45,413,496 G358R probably damaging Het
Cracr2a A G 6: 127,611,505 K209R probably damaging Het
Dmkn A G 7: 30,765,316 N32S unknown Het
Dusp13 T A 14: 21,740,137 N47I probably damaging Het
Elmo2 A G 2: 165,297,653 probably benign Het
Ephb6 T C 6: 41,614,238 F110L probably damaging Het
Gabrb2 T A 11: 42,591,907 N197K probably benign Het
Gdnf T A 15: 7,815,649 V41E possibly damaging Het
Gm21915 A G 9: 40,670,787 I59V possibly damaging Het
Gprin2 C T 14: 34,195,081 G244D possibly damaging Het
Grin2d T C 7: 45,833,357 probably benign Het
Ice2 A G 9: 69,410,840 D241G probably benign Het
Mios C T 6: 8,214,935 R44C possibly damaging Het
Nlrp5-ps T C 7: 14,586,711 noncoding transcript Het
Nyap2 C T 1: 81,087,471 R67* probably null Het
Olfr1031 T A 2: 85,992,045 V76E probably damaging Het
Olfr1094 T C 2: 86,829,226 I158T probably benign Het
Olfr1306 G T 2: 111,912,719 D70E probably damaging Het
Olfr1428 G A 19: 12,108,625 P81L probably benign Het
Olfr27 G T 9: 39,144,466 R122L possibly damaging Het
Otop2 G A 11: 115,329,146 A271T probably benign Het
Otulin A G 15: 27,619,630 probably benign Het
Pax1 A G 2: 147,368,428 Y361C probably damaging Het
Pcdhb12 A T 18: 37,437,640 N613I probably damaging Het
Plekha5 A G 6: 140,589,199 K173E probably damaging Het
Plin4 T A 17: 56,104,389 T881S probably damaging Het
Prex2 T A 1: 11,169,853 F898I probably damaging Het
Prr14l A T 5: 32,829,768 H794Q probably benign Het
Prss1 A T 6: 41,462,611 I93F probably benign Het
Ptpro C T 6: 137,414,241 probably benign Het
Rad1 T C 15: 10,486,642 C42R probably damaging Het
Rnf20 A G 4: 49,638,769 E197G probably benign Het
Setx A G 2: 29,172,324 E2260G probably damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Six2 A G 17: 85,685,188 S296P probably damaging Het
Smg1 T A 7: 118,210,879 probably benign Het
Spred2 T C 11: 19,998,215 V41A probably damaging Het
Ssu2 A T 6: 112,377,605 C219* probably null Het
Tbc1d9b T A 11: 50,149,736 V360D possibly damaging Het
Tdrd9 G A 12: 112,040,461 D920N probably damaging Het
Tyrp1 A G 4: 80,837,455 T154A possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Wac A C 18: 7,926,131 M596L possibly damaging Het
Zfhx2 G T 14: 55,064,557 P1990Q probably damaging Het
Zfp853 T C 5: 143,289,577 E96G unknown Het
Zzef1 G A 11: 72,910,326 probably null Het
Other mutations in Poli
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Poli APN 18 70525490 missense probably damaging 1.00
IGL01506:Poli APN 18 70509731 missense probably benign
IGL01958:Poli APN 18 70526586 missense possibly damaging 0.46
IGL02375:Poli APN 18 70523292 missense probably damaging 1.00
IGL02385:Poli APN 18 70526574 missense possibly damaging 0.93
IGL02480:Poli APN 18 70525406 missense probably benign 0.04
R0113:Poli UTSW 18 70528758 missense probably damaging 1.00
R0184:Poli UTSW 18 70522731 missense probably damaging 1.00
R0348:Poli UTSW 18 70523381 missense probably benign 0.00
R0710:Poli UTSW 18 70522890 splice site probably null
R1004:Poli UTSW 18 70525438 missense probably benign 0.31
R1264:Poli UTSW 18 70517503 missense probably benign 0.05
R1660:Poli UTSW 18 70509464 missense probably damaging 0.99
R1992:Poli UTSW 18 70508987 missense probably damaging 0.98
R4531:Poli UTSW 18 70517477 missense probably benign 0.41
R4816:Poli UTSW 18 70522751 missense probably damaging 1.00
R5393:Poli UTSW 18 70517428 nonsense probably null
R5404:Poli UTSW 18 70509432 missense probably benign 0.15
R5559:Poli UTSW 18 70509285 missense probably benign 0.02
R5957:Poli UTSW 18 70517440 missense probably benign
R6045:Poli UTSW 18 70517469 missense possibly damaging 0.75
R6385:Poli UTSW 18 70530001 start gained probably benign
R6807:Poli UTSW 18 70530151 intron probably null
R7024:Poli UTSW 18 70516849 missense possibly damaging 0.68
R7067:Poli UTSW 18 70509417 nonsense probably null
R7452:Poli UTSW 18 70508978 missense possibly damaging 0.94
R7653:Poli UTSW 18 70509627 missense probably benign
R7685:Poli UTSW 18 70525519 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGCTAACTGGGTAATTATCCCCTC -3'
(R):5'- AACTGCCAAGCGTCTCGAAG -3'

Sequencing Primer
(F):5'- CCACTTTCCAAATCACTGAATTAGTC -3'
(R):5'- CGTCTCGAAGTTCTGGGAATCAATAG -3'
Posted On2014-12-29