Incidental Mutation 'R2915:Olfr1428'
ID 254872
Institutional Source Beutler Lab
Gene Symbol Olfr1428
Ensembl Gene ENSMUSG00000067524
Gene Name olfactory receptor 1428
Synonyms GA_x6K02T2RE5P-2468394-2467450, MOR239-5
MMRRC Submission 040502-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.210) question?
Stock # R2915 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 12107716-12115897 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 12108625 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 81 (P81L)
Ref Sequence ENSEMBL: ENSMUSP00000147015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087824] [ENSMUST00000208391] [ENSMUST00000214103]
AlphaFold Q0VDY1
Predicted Effect probably benign
Transcript: ENSMUST00000087824
AA Change: P307L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085126
Gene: ENSMUSG00000067524
AA Change: P307L

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.1e-43 PFAM
Pfam:7TM_GPCR_Srsx 35 305 6.2e-6 PFAM
Pfam:7tm_1 41 303 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208391
AA Change: P81L

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000214103
AA Change: P307L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0745 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aif1 G A 17: 35,172,151 P44L probably benign Het
Arhgap11a A G 2: 113,833,508 V810A probably damaging Het
B3gnt6 T C 7: 98,193,593 N387D probably benign Het
Col5a2 C G 1: 45,413,496 G358R probably damaging Het
Cracr2a A G 6: 127,611,505 K209R probably damaging Het
Dmkn A G 7: 30,765,316 N32S unknown Het
Dusp13 T A 14: 21,740,137 N47I probably damaging Het
Elmo2 A G 2: 165,297,653 probably benign Het
Ephb6 T C 6: 41,614,238 F110L probably damaging Het
Gabrb2 T A 11: 42,591,907 N197K probably benign Het
Gdnf T A 15: 7,815,649 V41E possibly damaging Het
Gm21915 A G 9: 40,670,787 I59V possibly damaging Het
Gprin2 C T 14: 34,195,081 G244D possibly damaging Het
Grin2d T C 7: 45,833,357 probably benign Het
Ice2 A G 9: 69,410,840 D241G probably benign Het
Mios C T 6: 8,214,935 R44C possibly damaging Het
Nlrp5-ps T C 7: 14,586,711 noncoding transcript Het
Nyap2 C T 1: 81,087,471 R67* probably null Het
Olfr1031 T A 2: 85,992,045 V76E probably damaging Het
Olfr1094 T C 2: 86,829,226 I158T probably benign Het
Olfr1306 G T 2: 111,912,719 D70E probably damaging Het
Olfr27 G T 9: 39,144,466 R122L possibly damaging Het
Otop2 G A 11: 115,329,146 A271T probably benign Het
Otulin A G 15: 27,619,630 probably benign Het
Pax1 A G 2: 147,368,428 Y361C probably damaging Het
Pcdhb12 A T 18: 37,437,640 N613I probably damaging Het
Plekha5 A G 6: 140,589,199 K173E probably damaging Het
Plin4 T A 17: 56,104,389 T881S probably damaging Het
Poli A G 18: 70,522,700 probably null Het
Prex2 T A 1: 11,169,853 F898I probably damaging Het
Prr14l A T 5: 32,829,768 H794Q probably benign Het
Prss1 A T 6: 41,462,611 I93F probably benign Het
Ptpro C T 6: 137,414,241 probably benign Het
Rad1 T C 15: 10,486,642 C42R probably damaging Het
Rnf20 A G 4: 49,638,769 E197G probably benign Het
Setx A G 2: 29,172,324 E2260G probably damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Six2 A G 17: 85,685,188 S296P probably damaging Het
Smg1 T A 7: 118,210,879 probably benign Het
Spred2 T C 11: 19,998,215 V41A probably damaging Het
Ssu2 A T 6: 112,377,605 C219* probably null Het
Tbc1d9b T A 11: 50,149,736 V360D possibly damaging Het
Tdrd9 G A 12: 112,040,461 D920N probably damaging Het
Tyrp1 A G 4: 80,837,455 T154A possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Wac A C 18: 7,926,131 M596L possibly damaging Het
Zfhx2 G T 14: 55,064,557 P1990Q probably damaging Het
Zfp853 T C 5: 143,289,577 E96G unknown Het
Zzef1 G A 11: 72,910,326 probably null Het
Other mutations in Olfr1428
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03062:Olfr1428 APN 19 12109148 missense probably benign 0.00
BB006:Olfr1428 UTSW 19 12108754 missense unknown
BB016:Olfr1428 UTSW 19 12108754 missense unknown
IGL02796:Olfr1428 UTSW 19 12108884 missense possibly damaging 0.85
PIT4495001:Olfr1428 UTSW 19 12108712 missense possibly damaging 0.65
R0541:Olfr1428 UTSW 19 12109520 missense possibly damaging 0.85
R1169:Olfr1428 UTSW 19 12109489 missense probably benign
R1918:Olfr1428 UTSW 19 12109507 missense probably benign 0.06
R3835:Olfr1428 UTSW 19 12109400 missense possibly damaging 0.92
R4470:Olfr1428 UTSW 19 12109183 splice site probably null
R4682:Olfr1428 UTSW 19 12108685 missense probably damaging 1.00
R4751:Olfr1428 UTSW 19 12109177 missense probably damaging 1.00
R5467:Olfr1428 UTSW 19 12108659 missense probably benign 0.20
R5513:Olfr1428 UTSW 19 12109381 missense probably damaging 1.00
R6915:Olfr1428 UTSW 19 12109126 missense probably benign 0.25
R7385:Olfr1428 UTSW 19 12108697 missense probably damaging 1.00
R7569:Olfr1428 UTSW 19 12109021 missense possibly damaging 0.77
R7929:Olfr1428 UTSW 19 12108754 missense unknown
R8442:Olfr1428 UTSW 19 12108727 missense probably damaging 1.00
R9215:Olfr1428 UTSW 19 12108652 missense probably damaging 1.00
R9467:Olfr1428 UTSW 19 12108949 missense possibly damaging 0.56
R9753:Olfr1428 UTSW 19 12108692 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACACAAGTCAGGTTGCGCAG -3'
(R):5'- GGTGACTCTCCATTTTGTGC -3'

Sequencing Primer
(F):5'- GCGCAGATTGTCTAGACTCATC -3'
(R):5'- GCCCTGTGTTTATATCTATTGCAGGC -3'
Posted On 2014-12-29