Incidental Mutation 'R2916:Ephb2'
ID254875
Institutional Source Beutler Lab
Gene Symbol Ephb2
Ensembl Gene ENSMUSG00000028664
Gene NameEph receptor B2
SynonymsErk, eteck, Tyro5, Prkm5, Drt, Hek5, Sek3, Qek5, Cek5, Nuk
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.693) question?
Stock #R2916 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location136647539-136835988 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136683945 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 468 (D468G)
Ref Sequence ENSEMBL: ENSMUSP00000101472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059287] [ENSMUST00000105845] [ENSMUST00000105846]
Predicted Effect probably damaging
Transcript: ENSMUST00000059287
AA Change: D468G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058135
Gene: ENSMUSG00000028664
AA Change: D468G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EPH_lbd 20 197 7.37e-130 SMART
Pfam:GCC2_GCC3 261 304 8.1e-10 PFAM
FN3 325 417 1.75e-6 SMART
FN3 436 518 1.23e-10 SMART
Pfam:EphA2_TM 545 619 6e-25 PFAM
TyrKc 622 881 1.34e-138 SMART
SAM 911 978 1.18e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105845
AA Change: D468G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101471
Gene: ENSMUSG00000028664
AA Change: D468G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EPH_lbd 20 197 7.37e-130 SMART
Pfam:GCC2_GCC3 259 305 2.2e-10 PFAM
FN3 325 417 1.75e-6 SMART
FN3 436 517 1.41e-10 SMART
Pfam:EphA2_TM 543 618 2.1e-30 PFAM
TyrKc 621 880 1.34e-138 SMART
SAM 910 977 1.18e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105846
AA Change: D468G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101472
Gene: ENSMUSG00000028664
AA Change: D468G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EPH_lbd 20 197 7.37e-130 SMART
Pfam:GCC2_GCC3 259 305 2.2e-10 PFAM
FN3 325 417 1.75e-6 SMART
FN3 436 517 1.41e-10 SMART
Pfam:EphA2_TM 543 619 1e-30 PFAM
TyrKc 622 881 1.34e-138 SMART
SAM 911 978 1.18e-23 SMART
Predicted Effect unknown
Transcript: ENSMUST00000156558
AA Change: D135G
SMART Domains Protein: ENSMUSP00000116350
Gene: ENSMUSG00000028664
AA Change: D135G

DomainStartEndE-ValueType
FN3 1 85 6.48e1 SMART
FN3 104 186 1.23e-10 SMART
Pfam:EphA2_TM 213 276 2.5e-16 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Eph receptor family of receptor tyrosine kinase transmembrane glycoproteins. These receptors consist of an N-terminal glycosylated ligand-binding domain, a transmembrane region and an intracellular kinase domain. The encoded receptor preferentially binds membrane-bound ephrin-B ligands and is involved in nervous system and vascular development. This gene is used as a marker of intestinal stem cells. Homozygous knockout mice for this gene exhibit impaired axon guidance and vestibular function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal axon guidance, circling, head bobbing, and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa13 T C 15: 58,345,080 noncoding transcript Het
Brd7 A G 8: 88,342,780 I429T probably damaging Het
Btbd10 T C 7: 113,332,824 M124V probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Fig4 A G 10: 41,258,075 F404S probably damaging Het
Hcn3 A G 3: 89,147,613 S776P probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Il17re G A 6: 113,466,028 probably null Het
Mug2 A G 6: 122,074,724 probably null Het
Nudt9 C A 5: 104,055,558 A121E probably damaging Het
Olfr223 T C 11: 59,589,439 T217A probably benign Het
Pdcd11 AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 19: 47,113,437 probably benign Het
Pkdcc G C 17: 83,215,949 A162P probably benign Het
Rassf4 A G 6: 116,641,740 V194A probably damaging Het
Rps24 T C 14: 24,491,941 V23A probably benign Het
Six3 A T 17: 85,621,633 I132F probably benign Het
Srsf12 C T 4: 33,231,042 R179* probably null Het
Zbtb14 C T 17: 69,388,219 P304L probably damaging Het
Other mutations in Ephb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ephb2 APN 4 136657484 missense probably damaging 0.96
IGL00963:Ephb2 APN 4 136658951 missense probably benign 0.04
IGL01111:Ephb2 APN 4 136657410 missense probably benign 0.01
IGL01462:Ephb2 APN 4 136771370 missense possibly damaging 0.61
IGL01863:Ephb2 APN 4 136659777 missense probably benign 0.03
IGL02149:Ephb2 APN 4 136693914 missense probably damaging 1.00
IGL02232:Ephb2 APN 4 136657451 missense probably damaging 0.97
IGL02269:Ephb2 APN 4 136771049 missense possibly damaging 0.66
IGL02828:Ephb2 APN 4 136771150 missense probably benign 0.09
IGL03109:Ephb2 APN 4 136771544 missense probably damaging 1.00
IGL03284:Ephb2 APN 4 136661516 missense probably damaging 0.96
PIT4453001:Ephb2 UTSW 4 136660810 missense probably benign 0.00
R0004:Ephb2 UTSW 4 136657524 missense probably damaging 1.00
R0121:Ephb2 UTSW 4 136771057 missense probably damaging 0.99
R0539:Ephb2 UTSW 4 136655976 missense probably damaging 1.00
R0614:Ephb2 UTSW 4 136673365 missense probably benign 0.00
R0988:Ephb2 UTSW 4 136659708 missense possibly damaging 0.59
R1471:Ephb2 UTSW 4 136658951 missense probably benign 0.04
R1473:Ephb2 UTSW 4 136694058 missense possibly damaging 0.83
R1546:Ephb2 UTSW 4 136771009 missense probably damaging 0.99
R1639:Ephb2 UTSW 4 136693905 missense probably benign 0.10
R1725:Ephb2 UTSW 4 136659778 nonsense probably null
R1779:Ephb2 UTSW 4 136693825 missense possibly damaging 0.64
R1818:Ephb2 UTSW 4 136655336 missense probably benign 0.02
R2099:Ephb2 UTSW 4 136660755 missense probably damaging 1.00
R3885:Ephb2 UTSW 4 136771034 missense probably damaging 1.00
R4572:Ephb2 UTSW 4 136655940 missense probably damaging 1.00
R4709:Ephb2 UTSW 4 136696052 missense probably damaging 1.00
R4893:Ephb2 UTSW 4 136659753 missense probably damaging 0.99
R4981:Ephb2 UTSW 4 136696010 missense probably benign 0.09
R4992:Ephb2 UTSW 4 136660839 missense probably damaging 1.00
R5004:Ephb2 UTSW 4 136659699 missense possibly damaging 0.77
R5307:Ephb2 UTSW 4 136693787 missense possibly damaging 0.89
R5370:Ephb2 UTSW 4 136771570 missense probably benign 0.00
R5561:Ephb2 UTSW 4 136661406 missense probably damaging 1.00
R5643:Ephb2 UTSW 4 136771612 missense probably damaging 0.99
R5826:Ephb2 UTSW 4 136660737 missense probably damaging 1.00
R5858:Ephb2 UTSW 4 136672445 missense probably benign
R5867:Ephb2 UTSW 4 136675422 missense possibly damaging 0.81
R5990:Ephb2 UTSW 4 136696055 missense probably benign 0.03
R6000:Ephb2 UTSW 4 136684030 missense possibly damaging 0.76
R6156:Ephb2 UTSW 4 136661505 missense probably benign 0.44
R6413:Ephb2 UTSW 4 136771122 missense probably benign 0.08
R6577:Ephb2 UTSW 4 136657550 missense probably damaging 0.99
R6633:Ephb2 UTSW 4 136683996 missense probably benign 0.07
R6720:Ephb2 UTSW 4 136657502 missense probably damaging 0.99
R6795:Ephb2 UTSW 4 136673335 missense possibly damaging 0.88
R7235:Ephb2 UTSW 4 136693828 missense probably damaging 1.00
R7260:Ephb2 UTSW 4 136771574 missense probably damaging 0.96
R7328:Ephb2 UTSW 4 136658934 critical splice donor site probably null
R7404:Ephb2 UTSW 4 136771213 missense probably damaging 1.00
R7466:Ephb2 UTSW 4 136659065 missense probably damaging 1.00
R7524:Ephb2 UTSW 4 136659709 missense probably damaging 1.00
R7605:Ephb2 UTSW 4 136771108 missense probably damaging 1.00
R7611:Ephb2 UTSW 4 136660901 critical splice acceptor site probably null
R7777:Ephb2 UTSW 4 136771636 missense possibly damaging 0.92
R7889:Ephb2 UTSW 4 136771042 missense probably damaging 0.99
R7972:Ephb2 UTSW 4 136771042 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTGGCATATCGTTCAGACAG -3'
(R):5'- GGCTCTCGTGCTTCTAAAATAAG -3'

Sequencing Primer
(F):5'- TGGCATATCGTTCAGACAGACAGC -3'
(R):5'- AATAAGTTGTACTTCCTCATGCCTG -3'
Posted On2014-12-29