Incidental Mutation 'R2916:Six3'
ID254893
Institutional Source Beutler Lab
Gene Symbol Six3
Ensembl Gene ENSMUSG00000038805
Gene Namesine oculis-related homeobox 3
SynonymsE130112M24Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2916 (G1)
Quality Score169
Status Not validated
Chromosome17
Chromosomal Location85613608-85629302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85621633 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 132 (I132F)
Ref Sequence ENSEMBL: ENSMUSP00000125169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162695] [ENSMUST00000175898] [ENSMUST00000176081]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159030
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161688
Predicted Effect probably benign
Transcript: ENSMUST00000162695
AA Change: I132F

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000125169
Gene: ENSMUSG00000038805
AA Change: I132F

DomainStartEndE-ValueType
low complexity region 30 71 N/A INTRINSIC
HOX 208 269 1.26e-14 SMART
low complexity region 294 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175898
AA Change: I132F

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135677
Gene: ENSMUSG00000038805
AA Change: I132F

DomainStartEndE-ValueType
low complexity region 30 71 N/A INTRINSIC
HOX 208 269 1.26e-14 SMART
low complexity region 294 310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175913
Predicted Effect probably benign
Transcript: ENSMUST00000176081
AA Change: I132F

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135312
Gene: ENSMUSG00000038805
AA Change: I132F

DomainStartEndE-ValueType
low complexity region 51 92 N/A INTRINSIC
Pfam:SIX1_SD 109 223 6e-47 PFAM
HOX 229 290 6.5e-17 SMART
low complexity region 315 331 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188560
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sine oculis homeobox transcription factor family. The encoded protein plays a role in eye development. Mutations in this gene have been associated with holoprosencephaly type 2. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions of this gene die at birth with anterior structures of the head and brain undeveloped. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa13 T C 15: 58,345,080 noncoding transcript Het
Brd7 A G 8: 88,342,780 I429T probably damaging Het
Btbd10 T C 7: 113,332,824 M124V probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Ephb2 T C 4: 136,683,945 D468G probably damaging Het
Fig4 A G 10: 41,258,075 F404S probably damaging Het
Hcn3 A G 3: 89,147,613 S776P probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Il17re G A 6: 113,466,028 probably null Het
Mug2 A G 6: 122,074,724 probably null Het
Nudt9 C A 5: 104,055,558 A121E probably damaging Het
Olfr223 T C 11: 59,589,439 T217A probably benign Het
Pdcd11 AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 19: 47,113,437 probably benign Het
Pkdcc G C 17: 83,215,949 A162P probably benign Het
Rassf4 A G 6: 116,641,740 V194A probably damaging Het
Rps24 T C 14: 24,491,941 V23A probably benign Het
Srsf12 C T 4: 33,231,042 R179* probably null Het
Zbtb14 C T 17: 69,388,219 P304L probably damaging Het
Other mutations in Six3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03096:Six3 APN 17 85621937 missense possibly damaging 0.78
IGL03397:Six3 APN 17 85621646 missense probably damaging 1.00
FR4304:Six3 UTSW 17 85621368 small insertion probably benign
FR4340:Six3 UTSW 17 85621356 small insertion probably benign
FR4449:Six3 UTSW 17 85621362 small insertion probably benign
FR4548:Six3 UTSW 17 85621363 small insertion probably benign
FR4589:Six3 UTSW 17 85621365 small insertion probably benign
FR4737:Six3 UTSW 17 85621357 small insertion probably benign
FR4737:Six3 UTSW 17 85621358 small insertion probably benign
FR4737:Six3 UTSW 17 85621362 small insertion probably benign
FR4737:Six3 UTSW 17 85621363 small insertion probably benign
FR4737:Six3 UTSW 17 85621365 small insertion probably benign
FR4737:Six3 UTSW 17 85621368 small insertion probably benign
FR4976:Six3 UTSW 17 85621358 small insertion probably benign
FR4976:Six3 UTSW 17 85621371 small insertion probably benign
R0238:Six3 UTSW 17 85621390 missense probably damaging 1.00
R1264:Six3 UTSW 17 85621857 missense probably damaging 0.96
R2903:Six3 UTSW 17 85623855 missense probably damaging 0.96
R4994:Six3 UTSW 17 85621292 missense possibly damaging 0.91
R5393:Six3 UTSW 17 85623842 missense possibly damaging 0.93
R6524:Six3 UTSW 17 85621970 missense probably damaging 1.00
RF003:Six3 UTSW 17 85621370 small insertion probably benign
RF010:Six3 UTSW 17 85621355 small insertion probably benign
RF011:Six3 UTSW 17 85621368 small insertion probably benign
RF012:Six3 UTSW 17 85621368 small insertion probably benign
RF014:Six3 UTSW 17 85621356 small insertion probably benign
RF015:Six3 UTSW 17 85621370 small insertion probably benign
RF022:Six3 UTSW 17 85621356 small insertion probably benign
RF054:Six3 UTSW 17 85621355 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GGAAGAGTTGTCCATGTTCCAG -3'
(R):5'- AAGCAATGGGTCTTCTGCTCG -3'

Sequencing Primer
(F):5'- GAGTTGTCCATGTTCCAGTTGCC -3'
(R):5'- AGAGGGAACTTCTTGCGCAC -3'
Posted On2014-12-29