Incidental Mutation 'R2917:Prss50'
ID254909
Institutional Source Beutler Lab
Gene Symbol Prss50
Ensembl Gene ENSMUSG00000048752
Gene Nameprotease, serine 50
SynonymsTsp50
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R2917 (G1)
Quality Score216
Status Not validated
Chromosome9
Chromosomal Location110857967-110864629 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 110862545 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 306 (G306C)
Ref Sequence ENSEMBL: ENSMUSP00000059668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050958] [ENSMUST00000051097]
Predicted Effect probably benign
Transcript: ENSMUST00000050958
SMART Domains Protein: ENSMUSP00000060148
Gene: ENSMUSG00000049555

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 37 44 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000051097
AA Change: G306C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059668
Gene: ENSMUSG00000048752
AA Change: G306C

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
low complexity region 112 127 N/A INTRINSIC
Tryp_SPc 172 407 2.87e-43 SMART
low complexity region 425 439 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000196027
AA Change: G114*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,141 V568E probably damaging Het
Ap3m2 A G 8: 22,799,799 V96A probably benign Het
Bglap3 G C 3: 88,369,512 probably benign Het
Brd7 A G 8: 88,342,780 I429T probably damaging Het
Cacna1h A C 17: 25,395,452 L230R probably damaging Het
Camta2 A G 11: 70,680,961 F479S probably damaging Het
Cmya5 A T 13: 93,091,064 Y2505* probably null Het
Colgalt2 T A 1: 152,471,744 V143D probably damaging Het
Dnaja1 C T 4: 40,724,052 A71V possibly damaging Het
Gpr33 A G 12: 52,023,596 V220A possibly damaging Het
Hsph1 A T 5: 149,630,786 L168* probably null Het
Lig4 T A 8: 9,971,596 E728V possibly damaging Het
Mrps23 T C 11: 88,209,917 S75P probably damaging Het
Olfr223 T C 11: 59,589,439 T217A probably benign Het
Olfr313 A G 11: 58,817,488 N160S probably damaging Het
Rnf149 A T 1: 39,552,483 S392T probably benign Het
Scn8a T A 15: 101,039,732 F1661I probably damaging Het
Slc12a8 T A 16: 33,550,926 I144N probably damaging Het
Stxbp5l A T 16: 37,200,642 L630* probably null Het
Tmem131l G A 3: 83,937,580 R441* probably null Het
Trim63 T C 4: 134,323,151 Y249H probably damaging Het
Vmn2r125 T G 4: 156,351,269 L314R probably benign Het
Vwf A G 6: 125,608,143 N663D probably benign Het
Other mutations in Prss50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Prss50 APN 9 110862406 missense possibly damaging 0.89
IGL01838:Prss50 APN 9 110864492 missense probably benign 0.38
IGL03185:Prss50 APN 9 110858211 missense probably benign
R0347:Prss50 UTSW 9 110862350 missense probably damaging 0.97
R1545:Prss50 UTSW 9 110861268 missense probably damaging 0.99
R1660:Prss50 UTSW 9 110862489 missense possibly damaging 0.61
R1844:Prss50 UTSW 9 110858013 unclassified probably benign
R1969:Prss50 UTSW 9 110862381 missense probably damaging 0.97
R2025:Prss50 UTSW 9 110861260 missense probably benign 0.00
R2090:Prss50 UTSW 9 110862293 missense probably damaging 1.00
R4063:Prss50 UTSW 9 110858412 missense probably benign
R4799:Prss50 UTSW 9 110863796 missense probably damaging 0.99
R5763:Prss50 UTSW 9 110862449 nonsense probably null
R5984:Prss50 UTSW 9 110862386 missense probably damaging 0.97
R6159:Prss50 UTSW 9 110864303 missense probably benign 0.32
R6318:Prss50 UTSW 9 110861299 missense probably damaging 1.00
R7296:Prss50 UTSW 9 110861289 missense probably damaging 1.00
R7323:Prss50 UTSW 9 110863732 missense possibly damaging 0.83
R7720:Prss50 UTSW 9 110861335 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGTCATCATAAACCATGGC -3'
(R):5'- AGCAGTCGTGACTCTGAGAG -3'

Sequencing Primer
(F):5'- TGGCTACCAACCCAGACGG -3'
(R):5'- TGACTCTGAGAGGCCTGACTG -3'
Posted On2014-12-29