Incidental Mutation 'R2917:Olfr313'
ID254910
Institutional Source Beutler Lab
Gene Symbol Olfr313
Ensembl Gene ENSMUSG00000070438
Gene Nameolfactory receptor 313
SynonymsGA_x6K02T2NKPP-590035-589109, MOR222-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R2917 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58815000-58819450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58817488 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 160 (N160S)
Ref Sequence ENSEMBL: ENSMUSP00000150529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082220] [ENSMUST00000217506]
Predicted Effect probably damaging
Transcript: ENSMUST00000082220
AA Change: N160S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080852
Gene: ENSMUSG00000070438
AA Change: N160S

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 217 4.5e-9 PFAM
Pfam:7tm_1 39 288 5.2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217506
AA Change: N160S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,141 V568E probably damaging Het
Ap3m2 A G 8: 22,799,799 V96A probably benign Het
Bglap3 G C 3: 88,369,512 probably benign Het
Brd7 A G 8: 88,342,780 I429T probably damaging Het
Cacna1h A C 17: 25,395,452 L230R probably damaging Het
Camta2 A G 11: 70,680,961 F479S probably damaging Het
Cmya5 A T 13: 93,091,064 Y2505* probably null Het
Colgalt2 T A 1: 152,471,744 V143D probably damaging Het
Dnaja1 C T 4: 40,724,052 A71V possibly damaging Het
Gpr33 A G 12: 52,023,596 V220A possibly damaging Het
Hsph1 A T 5: 149,630,786 L168* probably null Het
Lig4 T A 8: 9,971,596 E728V possibly damaging Het
Mrps23 T C 11: 88,209,917 S75P probably damaging Het
Olfr223 T C 11: 59,589,439 T217A probably benign Het
Prss50 G T 9: 110,862,545 G306C probably null Het
Rnf149 A T 1: 39,552,483 S392T probably benign Het
Scn8a T A 15: 101,039,732 F1661I probably damaging Het
Slc12a8 T A 16: 33,550,926 I144N probably damaging Het
Stxbp5l A T 16: 37,200,642 L630* probably null Het
Tmem131l G A 3: 83,937,580 R441* probably null Het
Trim63 T C 4: 134,323,151 Y249H probably damaging Het
Vmn2r125 T G 4: 156,351,269 L314R probably benign Het
Vwf A G 6: 125,608,143 N663D probably benign Het
Other mutations in Olfr313
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4548:Olfr313 UTSW 11 58817440 missense possibly damaging 0.80
FR4976:Olfr313 UTSW 11 58817440 missense possibly damaging 0.80
LCD18:Olfr313 UTSW 11 58817440 missense possibly damaging 0.80
R0269:Olfr313 UTSW 11 58817149 missense probably damaging 1.00
R0617:Olfr313 UTSW 11 58817149 missense probably damaging 1.00
R0707:Olfr313 UTSW 11 58817751 missense probably damaging 1.00
R3085:Olfr313 UTSW 11 58817727 missense probably damaging 1.00
R4245:Olfr313 UTSW 11 58817778 missense probably damaging 1.00
R4991:Olfr313 UTSW 11 58817718 missense probably damaging 1.00
R5188:Olfr313 UTSW 11 58817320 missense probably damaging 0.96
R6985:Olfr313 UTSW 11 58817113 missense probably damaging 0.98
R7076:Olfr313 UTSW 11 58817164 missense probably benign 0.17
R7253:Olfr313 UTSW 11 58817540 nonsense probably null
R7553:Olfr313 UTSW 11 58817060 missense probably benign 0.10
R8204:Olfr313 UTSW 11 58817059 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGGGTCATCTCCTATCAAGAGTG -3'
(R):5'- AGAACTGTGGCCACAATGC -3'

Sequencing Primer
(F):5'- GTCATCTCCTATCAAGAGTGTGTAGC -3'
(R):5'- TGCCAATATAGGAGACCACTGTG -3'
Posted On2014-12-29