Incidental Mutation 'R2917:Slc12a8'
ID254918
Institutional Source Beutler Lab
Gene Symbol Slc12a8
Ensembl Gene ENSMUSG00000035506
Gene Namesolute carrier family 12 (potassium/chloride transporters), member 8
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2917 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location33517328-33664135 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33550926 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 144 (I144N)
Ref Sequence ENSEMBL: ENSMUSP00000112439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059056] [ENSMUST00000119173] [ENSMUST00000121925] [ENSMUST00000122427]
Predicted Effect probably damaging
Transcript: ENSMUST00000059056
AA Change: I144N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062337
Gene: ENSMUSG00000035506
AA Change: I144N

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 410 4e-24 PFAM
Pfam:AA_permease 43 409 5.3e-51 PFAM
low complexity region 481 496 N/A INTRINSIC
transmembrane domain 585 607 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119173
AA Change: I113N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113633
Gene: ENSMUSG00000035506
AA Change: I113N

DomainStartEndE-ValueType
Pfam:AA_permease_2 7 266 4.2e-15 PFAM
Pfam:AA_permease 12 267 1.9e-37 PFAM
transmembrane domain 295 317 N/A INTRINSIC
low complexity region 401 416 N/A INTRINSIC
transmembrane domain 505 527 N/A INTRINSIC
transmembrane domain 532 554 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121925
AA Change: I144N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112439
Gene: ENSMUSG00000035506
AA Change: I144N

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 409 2.4e-23 PFAM
Pfam:AA_permease 43 409 5e-50 PFAM
low complexity region 481 496 N/A INTRINSIC
transmembrane domain 585 607 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122427
AA Change: I144N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113164
Gene: ENSMUSG00000035506
AA Change: I144N

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 386 7.7e-18 PFAM
Pfam:AA_permease 43 381 1.3e-44 PFAM
low complexity region 455 470 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to be a candidate for psoriasis susceptibility. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,141 V568E probably damaging Het
Ap3m2 A G 8: 22,799,799 V96A probably benign Het
Bglap3 G C 3: 88,369,512 probably benign Het
Brd7 A G 8: 88,342,780 I429T probably damaging Het
Cacna1h A C 17: 25,395,452 L230R probably damaging Het
Camta2 A G 11: 70,680,961 F479S probably damaging Het
Cmya5 A T 13: 93,091,064 Y2505* probably null Het
Colgalt2 T A 1: 152,471,744 V143D probably damaging Het
Dnaja1 C T 4: 40,724,052 A71V possibly damaging Het
Gpr33 A G 12: 52,023,596 V220A possibly damaging Het
Hsph1 A T 5: 149,630,786 L168* probably null Het
Lig4 T A 8: 9,971,596 E728V possibly damaging Het
Mrps23 T C 11: 88,209,917 S75P probably damaging Het
Olfr223 T C 11: 59,589,439 T217A probably benign Het
Olfr313 A G 11: 58,817,488 N160S probably damaging Het
Prss50 G T 9: 110,862,545 G306C probably null Het
Rnf149 A T 1: 39,552,483 S392T probably benign Het
Scn8a T A 15: 101,039,732 F1661I probably damaging Het
Stxbp5l A T 16: 37,200,642 L630* probably null Het
Tmem131l G A 3: 83,937,580 R441* probably null Het
Trim63 T C 4: 134,323,151 Y249H probably damaging Het
Vmn2r125 T G 4: 156,351,269 L314R probably benign Het
Vwf A G 6: 125,608,143 N663D probably benign Het
Other mutations in Slc12a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Slc12a8 APN 16 33540897 missense probably damaging 1.00
IGL01701:Slc12a8 APN 16 33540910 missense probably damaging 1.00
IGL02024:Slc12a8 APN 16 33608198 missense probably damaging 1.00
IGL02223:Slc12a8 APN 16 33624690 missense probably damaging 1.00
IGL02637:Slc12a8 APN 16 33534960 missense probably benign 0.05
IGL03248:Slc12a8 APN 16 33551027 missense probably damaging 1.00
R0136:Slc12a8 UTSW 16 33608213 missense probably damaging 1.00
R0436:Slc12a8 UTSW 16 33551085 missense probably damaging 1.00
R0586:Slc12a8 UTSW 16 33658230 missense possibly damaging 0.87
R0669:Slc12a8 UTSW 16 33550904 missense possibly damaging 0.91
R0780:Slc12a8 UTSW 16 33646665 splice site probably null
R1170:Slc12a8 UTSW 16 33662977 missense probably damaging 1.00
R1383:Slc12a8 UTSW 16 33534987 missense probably damaging 1.00
R1707:Slc12a8 UTSW 16 33551007 missense probably damaging 1.00
R4092:Slc12a8 UTSW 16 33617121 missense probably damaging 1.00
R4532:Slc12a8 UTSW 16 33551033 missense probably damaging 1.00
R4604:Slc12a8 UTSW 16 33608159 missense probably damaging 1.00
R4638:Slc12a8 UTSW 16 33590323 missense possibly damaging 0.95
R4908:Slc12a8 UTSW 16 33606259 splice site probably null
R5148:Slc12a8 UTSW 16 33624918 missense probably benign 0.00
R5186:Slc12a8 UTSW 16 33617208 missense probably damaging 1.00
R5711:Slc12a8 UTSW 16 33590309 missense probably damaging 1.00
R5760:Slc12a8 UTSW 16 33624785 nonsense probably null
R6122:Slc12a8 UTSW 16 33625014 missense probably damaging 0.99
R6592:Slc12a8 UTSW 16 33617256 critical splice donor site probably null
R6995:Slc12a8 UTSW 16 33534893 nonsense probably null
R7602:Slc12a8 UTSW 16 33625124 missense probably benign 0.00
R7772:Slc12a8 UTSW 16 33550965 missense probably damaging 1.00
R7849:Slc12a8 UTSW 16 33624560 missense probably damaging 1.00
R7932:Slc12a8 UTSW 16 33624560 missense probably damaging 1.00
R8022:Slc12a8 UTSW 16 33625086 missense not run
Z1176:Slc12a8 UTSW 16 33540965 frame shift probably null
Z1176:Slc12a8 UTSW 16 33606173 missense not run
Predicted Primers PCR Primer
(F):5'- GGTTAGACCTGATGCTTCCTC -3'
(R):5'- AAAGCACTACACTCCAGGGG -3'

Sequencing Primer
(F):5'- GATGCTTCCTCCCAGACAGTG -3'
(R):5'- TACACTCCAGGGGCTTACC -3'
Posted On2014-12-29