Incidental Mutation 'R2917:Stxbp5l'
ID254919
Institutional Source Beutler Lab
Gene Symbol Stxbp5l
Ensembl Gene ENSMUSG00000022829
Gene Namesyntaxin binding protein 5-like
Synonymst2md1, insulin level locus 1, tomosyn-2, T2dm1, A830015P08Rik, LLGL4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2917 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location37114942-37384962 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 37200642 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 630 (L630*)
Ref Sequence ENSEMBL: ENSMUSP00000110435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023526] [ENSMUST00000114780] [ENSMUST00000114781] [ENSMUST00000114782] [ENSMUST00000114787]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000023526
SMART Domains Protein: ENSMUSP00000023526
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 2e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 7.6e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
low complexity region 790 804 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114780
AA Change: L630*
SMART Domains Protein: ENSMUSP00000110428
Gene: ENSMUSG00000022829
AA Change: L630*

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.6e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 731 988 3e-9 PFAM
PDB:1URQ|A 1038 1097 2e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114781
AA Change: L630*
SMART Domains Protein: ENSMUSP00000110429
Gene: ENSMUSG00000022829
AA Change: L630*

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.9e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 755 1012 3.1e-9 PFAM
PDB:1URQ|A 1062 1121 2e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114782
AA Change: L630*
SMART Domains Protein: ENSMUSP00000110430
Gene: ENSMUSG00000022829
AA Change: L630*

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 9.2e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 785 1045 3.1e-9 PFAM
PDB:1URQ|A 1095 1154 2e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114787
AA Change: L630*
SMART Domains Protein: ENSMUSP00000110435
Gene: ENSMUSG00000022829
AA Change: L630*

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 287 396 8.7e-35 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 811 1069 3.3e-9 PFAM
PDB:1URQ|A 1119 1178 2e-25 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149984
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to syntaxin-binding protein 5 and contains ten N-terminal WD40 repeats, four variable region WD40 repeats, and a C-terminal R-SNARE domain. Studies of the orthologous proteins in mouse and rat have shown that the encoded protein may inhibit exocytosis in neurosecretory cells, and may negatively regulate the secretion of insulin. A missense variant in this gene is likely the cause of an infantile-onset neurodegenerative disorder diagnosed in two siblings of consanguineous parents. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a QTL derived from BTBR exhibit increased fasting serum glucose and decreased fasting serum insulin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,141 V568E probably damaging Het
Ap3m2 A G 8: 22,799,799 V96A probably benign Het
Bglap3 G C 3: 88,369,512 probably benign Het
Brd7 A G 8: 88,342,780 I429T probably damaging Het
Cacna1h A C 17: 25,395,452 L230R probably damaging Het
Camta2 A G 11: 70,680,961 F479S probably damaging Het
Cmya5 A T 13: 93,091,064 Y2505* probably null Het
Colgalt2 T A 1: 152,471,744 V143D probably damaging Het
Dnaja1 C T 4: 40,724,052 A71V possibly damaging Het
Gpr33 A G 12: 52,023,596 V220A possibly damaging Het
Hsph1 A T 5: 149,630,786 L168* probably null Het
Lig4 T A 8: 9,971,596 E728V possibly damaging Het
Mrps23 T C 11: 88,209,917 S75P probably damaging Het
Olfr223 T C 11: 59,589,439 T217A probably benign Het
Olfr313 A G 11: 58,817,488 N160S probably damaging Het
Prss50 G T 9: 110,862,545 G306C probably null Het
Rnf149 A T 1: 39,552,483 S392T probably benign Het
Scn8a T A 15: 101,039,732 F1661I probably damaging Het
Slc12a8 T A 16: 33,550,926 I144N probably damaging Het
Tmem131l G A 3: 83,937,580 R441* probably null Het
Trim63 T C 4: 134,323,151 Y249H probably damaging Het
Vmn2r125 T G 4: 156,351,269 L314R probably benign Het
Vwf A G 6: 125,608,143 N663D probably benign Het
Other mutations in Stxbp5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Stxbp5l APN 16 37208100 missense possibly damaging 0.82
IGL01082:Stxbp5l APN 16 37204578 missense possibly damaging 0.89
IGL01448:Stxbp5l APN 16 37215979 missense probably damaging 0.99
IGL01475:Stxbp5l APN 16 37345092 missense possibly damaging 0.95
IGL01899:Stxbp5l APN 16 37200592 missense probably benign 0.19
IGL02232:Stxbp5l APN 16 37329895 missense probably damaging 1.00
IGL02389:Stxbp5l APN 16 37208205 missense probably benign 0.00
IGL02745:Stxbp5l APN 16 37186654 nonsense probably null
IGL03125:Stxbp5l APN 16 37186721 missense probably benign 0.02
R0058:Stxbp5l UTSW 16 37142374 missense possibly damaging 0.76
R0345:Stxbp5l UTSW 16 37288308 missense probably damaging 1.00
R0359:Stxbp5l UTSW 16 37216078 splice site probably benign
R0454:Stxbp5l UTSW 16 37134284 missense possibly damaging 0.94
R0525:Stxbp5l UTSW 16 37129797 critical splice donor site probably null
R0543:Stxbp5l UTSW 16 37208096 missense probably damaging 1.00
R0606:Stxbp5l UTSW 16 37204521 missense possibly damaging 0.46
R0607:Stxbp5l UTSW 16 37142432 missense probably benign 0.00
R1333:Stxbp5l UTSW 16 37247869 critical splice donor site probably null
R1593:Stxbp5l UTSW 16 37116052 missense probably damaging 0.96
R1605:Stxbp5l UTSW 16 37208111 missense probably benign 0.34
R1670:Stxbp5l UTSW 16 37290927 critical splice donor site probably null
R2077:Stxbp5l UTSW 16 37236275 missense possibly damaging 0.93
R2209:Stxbp5l UTSW 16 37216036 missense probably damaging 0.98
R2504:Stxbp5l UTSW 16 37115667 missense probably damaging 1.00
R2909:Stxbp5l UTSW 16 37208186 missense possibly damaging 0.89
R2918:Stxbp5l UTSW 16 37200642 nonsense probably null
R2935:Stxbp5l UTSW 16 37134189 missense possibly damaging 0.76
R3693:Stxbp5l UTSW 16 37241346 nonsense probably null
R3694:Stxbp5l UTSW 16 37241346 nonsense probably null
R3695:Stxbp5l UTSW 16 37241346 nonsense probably null
R4133:Stxbp5l UTSW 16 37208119 missense possibly damaging 0.80
R4180:Stxbp5l UTSW 16 37247880 missense probably benign 0.05
R4676:Stxbp5l UTSW 16 37255884 missense probably damaging 1.00
R4757:Stxbp5l UTSW 16 37188634 missense probably damaging 1.00
R4758:Stxbp5l UTSW 16 37134230 missense probably benign 0.18
R5105:Stxbp5l UTSW 16 37142372 missense probably benign 0.43
R5278:Stxbp5l UTSW 16 37186654 missense probably benign 0.19
R5358:Stxbp5l UTSW 16 37174326 missense probably damaging 0.99
R5411:Stxbp5l UTSW 16 37129851 missense probably damaging 1.00
R5773:Stxbp5l UTSW 16 37208097 missense probably damaging 1.00
R6539:Stxbp5l UTSW 16 37129815 missense probably damaging 1.00
R6869:Stxbp5l UTSW 16 37204448 missense possibly damaging 0.74
R6892:Stxbp5l UTSW 16 37188629 missense possibly damaging 0.94
R7369:Stxbp5l UTSW 16 37134341 missense probably benign 0.12
R7555:Stxbp5l UTSW 16 37323603 missense probably damaging 1.00
R7657:Stxbp5l UTSW 16 37210172 missense probably null 0.21
Z1088:Stxbp5l UTSW 16 37204489 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAAAGCAAACACCACTGGTAG -3'
(R):5'- AGCATTGTCTATCCACATACTTGC -3'

Sequencing Primer
(F):5'- ACTGGTAGATCTACTATCACATTAGC -3'
(R):5'- TGCCCCCATGTTATATATTTTTGAAG -3'
Posted On2014-12-29