Incidental Mutation 'R2928:Fcrl1'
ID254925
Institutional Source Beutler Lab
Gene Symbol Fcrl1
Ensembl Gene ENSMUSG00000059994
Gene NameFc receptor-like 1
SynonymsFcrh1, BXMAS1-like, IFGP1, moFcRH1L, moFcRH1S, A230020G22Rik, mBXMH1, moFcRH1, mIFGP1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2928 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location87376387-87402934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87391257 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 353 (N353S)
Ref Sequence ENSEMBL: ENSMUSP00000130936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072480] [ENSMUST00000163661] [ENSMUST00000167200] [ENSMUST00000191666] [ENSMUST00000194786]
Predicted Effect probably benign
Transcript: ENSMUST00000072480
AA Change: N333S

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000072300
Gene: ENSMUSG00000059994
AA Change: N333S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 28 113 4.03e-8 SMART
IG 123 204 1.35e0 SMART
transmembrane domain 221 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163661
AA Change: N353S

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000130936
Gene: ENSMUSG00000059994
AA Change: N353S

DomainStartEndE-ValueType
IG 48 133 4.03e-8 SMART
IG 143 224 1.35e0 SMART
transmembrane domain 241 263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167200
AA Change: N290S

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128235
Gene: ENSMUSG00000059994
AA Change: N290S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 28 113 4.03e-8 SMART
IG 123 204 1.35e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191666
SMART Domains Protein: ENSMUSP00000141916
Gene: ENSMUSG00000059994

DomainStartEndE-ValueType
IG_like 9 94 4.5e-2 SMART
IG 28 113 1.7e-10 SMART
IG 123 204 5.5e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193854
Predicted Effect probably benign
Transcript: ENSMUST00000194786
SMART Domains Protein: ENSMUSP00000142286
Gene: ENSMUSG00000059994

DomainStartEndE-ValueType
IG_like 9 94 4.5e-2 SMART
IG 28 113 1.7e-10 SMART
IG 123 204 5.5e-3 SMART
transmembrane domain 221 243 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin receptor superfamily and is one of several Fc receptor-like glycoproteins clustered on the long arm of chromosome 1. The encoded protein contains three extracellular C2-like immunoglobulin domains, a transmembrane domain and a cytoplasmic domain with two immunoreceptor-tyrosine activation motifs. This protein may play a role in the regulation of cancer cell growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc1 T C 2: 128,680,137 K167R probably damaging Het
Brpf1 T C 6: 113,322,046 V1127A possibly damaging Het
Cept1 G A 3: 106,531,152 T205I probably benign Het
Cpd T C 11: 76,846,374 D198G probably benign Het
Csad A G 15: 102,177,704 F464S probably damaging Het
Glb1l2 A T 9: 26,768,426 M410K probably benign Het
Gskip T A 12: 105,700,743 F127I probably damaging Het
Iqgap2 T C 13: 95,682,236 T671A probably benign Het
Olfr259 A T 2: 87,107,763 I208N possibly damaging Het
Tmem260 T C 14: 48,486,750 F352L probably damaging Het
Vmn2r22 T C 6: 123,637,443 N396S probably damaging Het
Other mutations in Fcrl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Fcrl1 APN 3 87389635 missense probably damaging 0.99
IGL01884:Fcrl1 APN 3 87384737 missense probably damaging 1.00
IGL02029:Fcrl1 APN 3 87376487 utr 5 prime probably benign
IGL02231:Fcrl1 APN 3 87385162 missense possibly damaging 0.94
IGL02231:Fcrl1 APN 3 87385163 missense probably damaging 1.00
IGL02405:Fcrl1 APN 3 87385767 missense probably damaging 0.99
IGL02858:Fcrl1 APN 3 87384705 missense probably damaging 1.00
IGL03133:Fcrl1 APN 3 87389392 missense probably benign 0.00
IGL03176:Fcrl1 APN 3 87391257 missense probably damaging 1.00
IGL03352:Fcrl1 APN 3 87385091 missense probably benign 0.01
R1497:Fcrl1 UTSW 3 87384802 missense probably damaging 1.00
R1569:Fcrl1 UTSW 3 87384705 missense probably damaging 1.00
R1581:Fcrl1 UTSW 3 87385723 missense possibly damaging 0.94
R1778:Fcrl1 UTSW 3 87385319 splice site probably benign
R1959:Fcrl1 UTSW 3 87376520 missense possibly damaging 0.92
R4677:Fcrl1 UTSW 3 87390256 missense possibly damaging 0.61
R5122:Fcrl1 UTSW 3 87385774 missense probably benign 0.35
R5507:Fcrl1 UTSW 3 87391242 missense probably benign 0.16
R6363:Fcrl1 UTSW 3 87385168 missense probably damaging 0.96
R6478:Fcrl1 UTSW 3 87389639 missense probably benign 0.41
R6559:Fcrl1 UTSW 3 87391253 missense probably benign 0.33
R6985:Fcrl1 UTSW 3 87389650 missense probably benign
R7291:Fcrl1 UTSW 3 87385781 critical splice donor site probably null
Z1177:Fcrl1 UTSW 3 87389363 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATTCCTTGGCAGGGACAC -3'
(R):5'- GGTGAAGGACCCATCTAATGAAC -3'

Sequencing Primer
(F):5'- GAGTCACAGGCTCTTTTGATAATGC -3'
(R):5'- CCATCTAATGAACCGCAGTGTGTG -3'
Posted On2014-12-29