Mutagenetix > Incidental Mutation

Incidental Mutation 'R2928:Fcrl1'

254925

Institutional Source

Beutler Lab

Gene Symbol

Fcrl1

Ensembl Gene

ENSMUSG00000059994

Gene Name

Fc receptor-like 1

Synonyms

Fcrh1, BXMAS1-like, IFGP1, moFcRH1L, moFcRH1S, A230020G22Rik, mBXMH1, moFcRH1, mIFGP1

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2928 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87376387-87402934 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87391257 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 353 (N353S)

Ref Sequence

ENSEMBL: ENSMUSP00000130936 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072480] [ENSMUST00000163661] [ENSMUST00000167200] [ENSMUST00000191666] [ENSMUST00000194786]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000072480
AA Change: N333S

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000072300
Gene: ENSMUSG00000059994
AA Change: N333S

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
IG	28	113	4.03e-8	SMART
IG	123	204	1.35e0	SMART
transmembrane domain	221	243	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163661
AA Change: N353S

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000130936
Gene: ENSMUSG00000059994
AA Change: N353S

Domain	Start	End	E-Value	Type
IG	48	133	4.03e-8	SMART
IG	143	224	1.35e0	SMART
transmembrane domain	241	263	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167200
AA Change: N290S

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000128235
Gene: ENSMUSG00000059994
AA Change: N290S

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
IG	28	113	4.03e-8	SMART
IG	123	204	1.35e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000191666

SMART Domains

Protein: ENSMUSP00000141916
Gene: ENSMUSG00000059994

Domain	Start	End	E-Value	Type
IG_like	9	94	4.5e-2	SMART
IG	28	113	1.7e-10	SMART
IG	123	204	5.5e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193854

Predicted Effect

probably benign
Transcript: ENSMUST00000194786

SMART Domains

Protein: ENSMUSP00000142286
Gene: ENSMUSG00000059994

Domain	Start	End	E-Value	Type
IG_like	9	94	4.5e-2	SMART
IG	28	113	1.7e-10	SMART
IG	123	204	5.5e-3	SMART
transmembrane domain	221	243	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin receptor superfamily and is one of several Fc receptor-like glycoproteins clustered on the long arm of chromosome 1. The encoded protein contains three extracellular C2-like immunoglobulin domains, a transmembrane domain and a cytoplasmic domain with two immunoreceptor-tyrosine activation motifs. This protein may play a role in the regulation of cancer cell growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]

Allele List at MGI

Other mutations in this stock

Total: 11 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anapc1	T	C	2: 128,680,137	K167R	probably damaging	Het
Brpf1	T	C	6: 113,322,046	V1127A	possibly damaging	Het
Cept1	G	A	3: 106,531,152	T205I	probably benign	Het
Cpd	T	C	11: 76,846,374	D198G	probably benign	Het
Csad	A	G	15: 102,177,704	F464S	probably damaging	Het
Glb1l2	A	T	9: 26,768,426	M410K	probably benign	Het
Gskip	T	A	12: 105,700,743	F127I	probably damaging	Het
Iqgap2	T	C	13: 95,682,236	T671A	probably benign	Het
Olfr259	A	T	2: 87,107,763	I208N	possibly damaging	Het
Tmem260	T	C	14: 48,486,750	F352L	probably damaging	Het
Vmn2r22	T	C	6: 123,637,443	N396S	probably damaging	Het

Other mutations in Fcrl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Fcrl1	APN	3	87389635	missense	probably damaging	0.99
IGL01884:Fcrl1	APN	3	87384737	missense	probably damaging	1.00
IGL02029:Fcrl1	APN	3	87376487	utr 5 prime	probably benign
IGL02231:Fcrl1	APN	3	87385162	missense	possibly damaging	0.94
IGL02231:Fcrl1	APN	3	87385163	missense	probably damaging	1.00
IGL02405:Fcrl1	APN	3	87385767	missense	probably damaging	0.99
IGL02858:Fcrl1	APN	3	87384705	missense	probably damaging	1.00
IGL03133:Fcrl1	APN	3	87389392	missense	probably benign	0.00
IGL03176:Fcrl1	APN	3	87391257	missense	probably damaging	1.00
IGL03352:Fcrl1	APN	3	87385091	missense	probably benign	0.01
R1497:Fcrl1	UTSW	3	87384802	missense	probably damaging	1.00
R1569:Fcrl1	UTSW	3	87384705	missense	probably damaging	1.00
R1581:Fcrl1	UTSW	3	87385723	missense	possibly damaging	0.94
R1778:Fcrl1	UTSW	3	87385319	splice site	probably benign
R1959:Fcrl1	UTSW	3	87376520	missense	possibly damaging	0.92
R4677:Fcrl1	UTSW	3	87390256	missense	possibly damaging	0.61
R5122:Fcrl1	UTSW	3	87385774	missense	probably benign	0.35
R5507:Fcrl1	UTSW	3	87391242	missense	probably benign	0.16
R6363:Fcrl1	UTSW	3	87385168	missense	probably damaging	0.96
R6478:Fcrl1	UTSW	3	87389639	missense	probably benign	0.41
R6559:Fcrl1	UTSW	3	87391253	missense	probably benign	0.33
R6985:Fcrl1	UTSW	3	87389650	missense	probably benign
R7291:Fcrl1	UTSW	3	87385781	critical splice donor site	probably null
R9649:Fcrl1	UTSW	3	87384611	missense	possibly damaging	0.68
Z1177:Fcrl1	UTSW	3	87389363	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAATTCCTTGGCAGGGACAC -3'
(R):5'- GGTGAAGGACCCATCTAATGAAC -3'

Sequencing Primer
(F):5'- GAGTCACAGGCTCTTTTGATAATGC -3'
(R):5'- CCATCTAATGAACCGCAGTGTGTG -3'

Posted On

2014-12-29