ID | 254935 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Symbol | Gskip | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ensembl Gene | ENSMUSG00000044715 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | GSK3B interacting protein | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | 4933433P14Rik | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Numbers | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Essential gene? | Probably non essential (E-score: 0.180) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Stock # | R2928 (G1) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Quality Score | 225 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Status | Not validated | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 12 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 105651611-105669317 bp(+) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Type of Mutation | missense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DNA Base Change (assembly) | T to A at 105667002 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Zygosity | Heterozygous | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Phenylalanine to Isoleucine at position 127 (F127I) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ref Sequence | ENSEMBL: ENSMUSP00000057939 (fasta) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for transcript(s): [ENSMUST00000051934] [ENSMUST00000222284] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | no structure available at present | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
probably damaging Transcript: ENSMUST00000051934 AA Change: F127I PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000057939 Gene: ENSMUSG00000044715 AA Change: F127I
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
probably benign Transcript: ENSMUST00000222284 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coding Region Coverage |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Validation Efficiency | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved as a negative regulator of GSK3-beta in the Wnt signaling pathway. The encoded protein may play a role in the retinoic acid signaling pathway by regulating the functional interactions between GSK3-beta, beta-catenin and cyclin D1, and it regulates the beta-catenin/N-cadherin pool. The encoded protein contains a GSK3-beta interacting domain (GID) in its C-terminus, which is similar to the GID of Axin. The protein also contains an evolutionarily conserved RII-binding domain, which facilitates binding with protein kinase-A and GSK3-beta, enabling its role as an A-kinase anchoring protein. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2012] PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial lethality between E16.5 and E1.5, complete lethality at birth, cyanosis, primary atelectasis resulting in respiratory failure and cleft secondary palate due to delayed ossification in the upper jaw. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Allele List at MGI | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Other mutations in this stock |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Other mutations in Gskip |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Primers |
PCR Primer (F):5'- GAAACGGTGTCACTGCACAAG -3' (R):5'- CAAAAGCCTGCGTGTGAAG -3' Sequencing Primer (F):5'- CTGCACAAGCCCTTCAGG -3' (R):5'- CCTGCGTGTGAAGGAATGGC -3' |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Posted On | 2014-12-29 |