Incidental Mutation 'R2928:Tmem260'
ID 254936
Institutional Source Beutler Lab
Gene Symbol Tmem260
Ensembl Gene ENSMUSG00000036339
Gene Name transmembrane protein 260
Synonyms 6720456H20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2928 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 48446124-48524246 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 48486750 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 352 (F352L)
Ref Sequence ENSEMBL: ENSMUSP00000154360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111735] [ENSMUST00000124720] [ENSMUST00000153765] [ENSMUST00000226422] [ENSMUST00000227440] [ENSMUST00000228697]
AlphaFold Q8BMD6
Predicted Effect probably damaging
Transcript: ENSMUST00000111735
AA Change: F352L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107364
Gene: ENSMUSG00000036339
AA Change: F352L

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Pfam:DUF2723 48 211 1.9e-43 PFAM
transmembrane domain 316 338 N/A INTRINSIC
transmembrane domain 353 372 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124720
AA Change: F200L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118376
Gene: ENSMUSG00000036339
AA Change: F200L

DomainStartEndE-ValueType
Pfam:DUF2723 1 61 4.6e-9 PFAM
transmembrane domain 65 87 N/A INTRINSIC
transmembrane domain 164 186 N/A INTRINSIC
transmembrane domain 201 220 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133744
Predicted Effect probably benign
Transcript: ENSMUST00000153765
SMART Domains Protein: ENSMUSP00000116155
Gene: ENSMUSG00000036339

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Pfam:DUF2723 48 111 8.3e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226373
Predicted Effect probably damaging
Transcript: ENSMUST00000226422
AA Change: F352L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227440
AA Change: F352L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228697
AA Change: F162L

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc1 T C 2: 128,680,137 K167R probably damaging Het
Brpf1 T C 6: 113,322,046 V1127A possibly damaging Het
Cept1 G A 3: 106,531,152 T205I probably benign Het
Cpd T C 11: 76,846,374 D198G probably benign Het
Csad A G 15: 102,177,704 F464S probably damaging Het
Fcrl1 A G 3: 87,391,257 N353S probably benign Het
Glb1l2 A T 9: 26,768,426 M410K probably benign Het
Gskip T A 12: 105,700,743 F127I probably damaging Het
Iqgap2 T C 13: 95,682,236 T671A probably benign Het
Olfr259 A T 2: 87,107,763 I208N possibly damaging Het
Vmn2r22 T C 6: 123,637,443 N396S probably damaging Het
Other mutations in Tmem260
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Tmem260 APN 14 48486879 missense probably benign 0.27
IGL00338:Tmem260 APN 14 48477636 missense probably damaging 0.97
IGL00508:Tmem260 APN 14 48509121 missense probably damaging 0.99
IGL01308:Tmem260 APN 14 48511958 missense probably damaging 1.00
IGL01548:Tmem260 APN 14 48480325 missense possibly damaging 0.60
IGL01952:Tmem260 APN 14 48472476 missense probably damaging 1.00
IGL03068:Tmem260 APN 14 48486914 splice site probably benign
IGL03081:Tmem260 APN 14 48496293 missense probably benign 0.14
R0131:Tmem260 UTSW 14 48483322 nonsense probably null
R0131:Tmem260 UTSW 14 48483322 nonsense probably null
R0132:Tmem260 UTSW 14 48483322 nonsense probably null
R0149:Tmem260 UTSW 14 48452047 missense possibly damaging 0.88
R0361:Tmem260 UTSW 14 48452047 missense possibly damaging 0.88
R0396:Tmem260 UTSW 14 48486867 missense possibly damaging 0.83
R0524:Tmem260 UTSW 14 48472478 missense probably benign 0.00
R1734:Tmem260 UTSW 14 48509093 missense probably benign 0.00
R2152:Tmem260 UTSW 14 48477609 missense possibly damaging 0.62
R2474:Tmem260 UTSW 14 48496324 missense probably null 0.90
R2999:Tmem260 UTSW 14 48484989 missense possibly damaging 0.92
R3030:Tmem260 UTSW 14 48485001 missense probably damaging 1.00
R4273:Tmem260 UTSW 14 48505304 missense probably benign 0.11
R4276:Tmem260 UTSW 14 48477636 missense probably damaging 0.97
R4277:Tmem260 UTSW 14 48477636 missense probably damaging 0.97
R4278:Tmem260 UTSW 14 48477636 missense probably damaging 0.97
R4791:Tmem260 UTSW 14 48511994 intron probably benign
R4792:Tmem260 UTSW 14 48511994 intron probably benign
R4810:Tmem260 UTSW 14 48472473 missense probably damaging 0.99
R5189:Tmem260 UTSW 14 48509116 missense probably benign 0.01
R5280:Tmem260 UTSW 14 48505259 missense probably benign 0.02
R5289:Tmem260 UTSW 14 48486810 missense possibly damaging 0.79
R5322:Tmem260 UTSW 14 48486849 missense probably damaging 0.99
R5491:Tmem260 UTSW 14 48512170 splice site probably null
R5593:Tmem260 UTSW 14 48474044 missense probably benign 0.38
R5606:Tmem260 UTSW 14 48484980 missense probably damaging 1.00
R5824:Tmem260 UTSW 14 48505328 missense probably damaging 1.00
R5947:Tmem260 UTSW 14 48486801 missense possibly damaging 0.93
R6587:Tmem260 UTSW 14 48496456 splice site probably null
R7234:Tmem260 UTSW 14 48505329 nonsense probably null
R7236:Tmem260 UTSW 14 48509190 splice site probably null
R7836:Tmem260 UTSW 14 48509062 missense probably benign 0.04
R8795:Tmem260 UTSW 14 48451913 missense probably damaging 1.00
R8895:Tmem260 UTSW 14 48500388 unclassified probably benign
R9056:Tmem260 UTSW 14 48480317 missense probably benign
R9096:Tmem260 UTSW 14 48520346 missense unknown
R9384:Tmem260 UTSW 14 48486819 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGTGGTTCTAAGGAGACAGTG -3'
(R):5'- AGGTAACCGGGTGCTGTTAC -3'

Sequencing Primer
(F):5'- GCACATGCCCAATTAGGAAG -3'
(R):5'- TGCTGTTACCTGTAATTTGAGTATAC -3'
Posted On 2014-12-29