Incidental Mutation 'R0317:Col4a3bp'
ID25494
Institutional Source Beutler Lab
Gene Symbol Col4a3bp
Ensembl Gene ENSMUSG00000021669
Gene Namecollagen, type IV, alpha 3 (Goodpasture antigen) binding protein
SynonymsGPBP, 2810404O15Rik, Cert, ceramide transport protein, 9230101K08Rik
MMRRC Submission 038527-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0317 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location96542618-96640167 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 96634121 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 487 (R487*)
Ref Sequence ENSEMBL: ENSMUSP00000136766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077672] [ENSMUST00000109444] [ENSMUST00000179226]
Predicted Effect probably null
Transcript: ENSMUST00000077672
AA Change: R513*
SMART Domains Protein: ENSMUSP00000076856
Gene: ENSMUSG00000021669
AA Change: R513*

DomainStartEndE-ValueType
PH 24 119 4.52e-21 SMART
low complexity region 138 150 N/A INTRINSIC
coiled coil region 273 301 N/A INTRINSIC
START 398 619 1.15e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109444
AA Change: R487*
SMART Domains Protein: ENSMUSP00000105070
Gene: ENSMUSG00000021669
AA Change: R487*

DomainStartEndE-ValueType
PH 24 119 4.52e-21 SMART
low complexity region 138 150 N/A INTRINSIC
coiled coil region 273 301 N/A INTRINSIC
START 372 593 1.15e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000179226
AA Change: R487*
SMART Domains Protein: ENSMUSP00000136766
Gene: ENSMUSG00000021669
AA Change: R487*

DomainStartEndE-ValueType
PH 24 119 4.52e-21 SMART
low complexity region 138 150 N/A INTRINSIC
coiled coil region 273 301 N/A INTRINSIC
START 372 593 1.15e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223471
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinase that specifically phosphorylates the N-terminal region of the non-collagenous domain of the alpha 3 chain of type IV collagen, known as the Goodpasture antigen. Goodpasture disease is the result of an autoimmune response directed at this antigen. One isoform of this protein is also involved in ceramide intracellular transport. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display embryonic lethality during organogenesis with reduced embryo size, impaired heart function, abnormal heart morphology, abnormal mitochondrial morphology and physiology, abnormal endoplasmic reticulum morphology, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,293,459 V1774A probably damaging Het
Adam34 G A 8: 43,652,251 P119L probably benign Het
Ap3b2 T C 7: 81,463,681 probably null Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Bcl11a A T 11: 24,172,697 probably null Het
Cab39 A G 1: 85,849,160 E322G probably damaging Het
Cad C A 5: 31,072,321 P1382Q probably benign Het
Cc2d2a T C 5: 43,706,901 probably null Het
Cela2a A T 4: 141,821,700 probably null Het
Ces1e A C 8: 93,224,039 I38S probably benign Het
Ces1f A T 8: 93,263,391 F364I probably benign Het
Chgb A G 2: 132,793,811 T558A probably benign Het
Cnpy4 C T 5: 138,192,812 Q217* probably null Het
Crlf1 A G 8: 70,498,599 T43A probably benign Het
Dnah7b T A 1: 46,134,656 M707K probably damaging Het
Ets2 G A 16: 95,712,149 S123N probably damaging Het
Fam196b C A 11: 34,402,826 D289E possibly damaging Het
Fry T C 5: 150,471,468 F304S probably damaging Het
Gadd45gip1 G A 8: 84,834,116 R120H probably benign Het
Gbf1 A G 19: 46,254,020 T96A probably benign Het
Ggn T A 7: 29,171,090 M1K probably null Het
Gm5239 A G 18: 35,536,916 T112A probably benign Het
Kif1bp A T 10: 62,578,082 probably null Het
Lrrc15 A T 16: 30,273,743 H259Q probably benign Het
Lysmd4 A G 7: 67,226,297 Y236C probably damaging Het
Med29 T C 7: 28,386,859 T175A possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Myh1 T C 11: 67,217,512 L1308P probably damaging Het
Nphp4 T A 4: 152,551,931 probably null Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pgm5 A G 19: 24,824,399 I155T possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Phactr4 T A 4: 132,386,930 K51I probably damaging Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Rab11a A G 9: 64,725,553 S24P probably damaging Het
Rasef T C 4: 73,748,562 Q160R probably damaging Het
Rbl2 A G 8: 91,087,144 D339G probably benign Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rfc1 A T 5: 65,296,052 probably null Het
Scarb1 A G 5: 125,289,692 V59A probably damaging Het
Slc2a4 C T 11: 69,946,356 V85M probably damaging Het
Slc6a12 A G 6: 121,358,625 I291V possibly damaging Het
Slco3a1 A C 7: 74,504,426 Y104D probably damaging Het
Suz12 T A 11: 79,999,078 D13E probably damaging Het
Tlr1 G T 5: 64,925,967 C422* probably null Het
Tmco1 T C 1: 167,325,893 V114A probably damaging Het
Trpa1 T C 1: 14,881,632 T948A probably benign Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Ufsp2 G A 8: 45,992,233 probably null Het
Veph1 T C 3: 66,171,975 D373G probably benign Het
Vmn1r206 A G 13: 22,620,960 S26P possibly damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Wnk4 T C 11: 101,268,804 S612P probably benign Het
Zfp503 T C 14: 21,986,459 K130E probably benign Het
Zkscan16 G A 4: 58,957,602 C628Y possibly damaging Het
Other mutations in Col4a3bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Col4a3bp APN 13 96614802 missense probably damaging 0.99
IGL02121:Col4a3bp APN 13 96599474 missense probably benign 0.45
IGL02207:Col4a3bp APN 13 96624792 critical splice donor site probably null
IGL02285:Col4a3bp APN 13 96616482 missense probably benign 0.10
IGL02425:Col4a3bp APN 13 96609882 missense probably damaging 1.00
IGL02749:Col4a3bp APN 13 96629135 missense possibly damaging 0.60
IGL03288:Col4a3bp APN 13 96634192 missense probably benign 0.00
PIT4508001:Col4a3bp UTSW 13 96630776 missense probably damaging 1.00
R0197:Col4a3bp UTSW 13 96549287 missense probably benign 0.05
R2103:Col4a3bp UTSW 13 96634886 missense probably damaging 1.00
R2104:Col4a3bp UTSW 13 96634886 missense probably damaging 1.00
R4664:Col4a3bp UTSW 13 96599457 missense probably benign 0.01
R4782:Col4a3bp UTSW 13 96612265 missense probably benign
R4824:Col4a3bp UTSW 13 96616487 missense probably benign
R5060:Col4a3bp UTSW 13 96603155 missense probably benign 0.37
R5131:Col4a3bp UTSW 13 96614835 missense probably damaging 1.00
R5385:Col4a3bp UTSW 13 96629067 missense possibly damaging 0.94
R5503:Col4a3bp UTSW 13 96543239 missense possibly damaging 0.61
R6034:Col4a3bp UTSW 13 96609800 missense probably benign 0.06
R6034:Col4a3bp UTSW 13 96609800 missense probably benign 0.06
R7193:Col4a3bp UTSW 13 96630833 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATACTGGACCTCTGCAAGGACTCG -3'
(R):5'- ACAAGGGCTGTCCCAAGCAATC -3'

Sequencing Primer
(F):5'- GAGTGTCTCCACCTAAAGTCG -3'
(R):5'- CAAATCAATTATCTGTGTGAGTGGG -3'
Posted On2013-04-16