Incidental Mutation 'R2929:Ro60'
ID 254940
Institutional Source Beutler Lab
Gene Symbol Ro60
Ensembl Gene ENSMUSG00000018199
Gene Name Ro60, Y RNA binding protein
Synonyms A530054J02Rik, Ssa, Trove2, SS-A/Ro, 1810007I17Rik, Ssa2
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R2929 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 143626528-143652794 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 143633616 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 494 (A494V)
Ref Sequence ENSEMBL: ENSMUSP00000125623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159879]
AlphaFold O08848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000018343
Predicted Effect possibly damaging
Transcript: ENSMUST00000159879
AA Change: A494V

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125623
Gene: ENSMUSG00000018199
AA Change: A494V

DomainStartEndE-ValueType
Pfam:TROVE 16 369 9.7e-99 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice develop symptoms similar to those observed in patients with lupus, including increased photosensitivity and membranoproliferative glomerulonephritis. The production of autoantibodies is detected in both homozygous and heterozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd177 G A 7: 24,453,704 (GRCm39) Q396* probably null Het
Cdadc1 A T 14: 59,835,284 (GRCm39) M1K probably null Het
Cdc23 ACC AC 18: 34,770,371 (GRCm39) probably null Het
Cnnm3 T A 1: 36,563,140 (GRCm39) F701L possibly damaging Het
Cul7 C G 17: 46,962,526 (GRCm39) D52E probably benign Het
Dennd4a T C 9: 64,759,699 (GRCm39) V268A possibly damaging Het
Deup1 C T 9: 15,486,484 (GRCm39) V399I probably benign Het
Dscam T A 16: 96,486,612 (GRCm39) Q1021L possibly damaging Het
Dst A T 1: 34,206,143 (GRCm39) K932* probably null Het
Neurl2 T C 2: 164,675,264 (GRCm39) N33D possibly damaging Het
Pnma8b T C 7: 16,680,617 (GRCm39) S534P possibly damaging Het
Pole2 G A 12: 69,256,712 (GRCm39) T271M probably benign Het
Ppfibp2 A G 7: 107,296,858 (GRCm39) M191V probably damaging Het
Rad51ap2 A G 12: 11,507,185 (GRCm39) Q369R probably benign Het
Rbm45 A G 2: 76,208,763 (GRCm39) I300V probably benign Het
Sco1 T A 11: 66,954,748 (GRCm39) I251K probably damaging Het
Spmip4 G A 6: 50,551,285 (GRCm39) T388I probably benign Het
Zfp202 T C 9: 40,122,984 (GRCm39) V582A possibly damaging Het
Zfp219 T A 14: 52,246,436 (GRCm39) E230D probably benign Het
Other mutations in Ro60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Ro60 APN 1 143,637,120 (GRCm39) missense probably benign 0.29
IGL01578:Ro60 APN 1 143,637,038 (GRCm39) missense probably damaging 0.99
IGL02006:Ro60 APN 1 143,636,084 (GRCm39) splice site probably benign
IGL02155:Ro60 APN 1 143,637,007 (GRCm39) critical splice donor site probably null
IGL02219:Ro60 APN 1 143,637,013 (GRCm39) missense possibly damaging 0.94
IGL02637:Ro60 APN 1 143,646,526 (GRCm39) missense probably damaging 1.00
IGL03013:Ro60 APN 1 143,646,446 (GRCm39) missense probably damaging 1.00
IGL03075:Ro60 APN 1 143,646,509 (GRCm39) missense probably benign
R0415:Ro60 UTSW 1 143,635,813 (GRCm39) missense probably benign 0.00
R0443:Ro60 UTSW 1 143,641,661 (GRCm39) splice site probably benign
R0479:Ro60 UTSW 1 143,633,489 (GRCm39) missense possibly damaging 0.72
R1696:Ro60 UTSW 1 143,633,575 (GRCm39) missense probably damaging 0.99
R1728:Ro60 UTSW 1 143,635,772 (GRCm39) missense probably benign
R1728:Ro60 UTSW 1 143,635,752 (GRCm39) missense probably benign
R1729:Ro60 UTSW 1 143,635,772 (GRCm39) missense probably benign
R1729:Ro60 UTSW 1 143,635,752 (GRCm39) missense probably benign
R1730:Ro60 UTSW 1 143,635,772 (GRCm39) missense probably benign
R1730:Ro60 UTSW 1 143,635,752 (GRCm39) missense probably benign
R1739:Ro60 UTSW 1 143,635,772 (GRCm39) missense probably benign
R1739:Ro60 UTSW 1 143,635,752 (GRCm39) missense probably benign
R1762:Ro60 UTSW 1 143,635,772 (GRCm39) missense probably benign
R1762:Ro60 UTSW 1 143,635,752 (GRCm39) missense probably benign
R1783:Ro60 UTSW 1 143,635,772 (GRCm39) missense probably benign
R1783:Ro60 UTSW 1 143,635,752 (GRCm39) missense probably benign
R1784:Ro60 UTSW 1 143,635,772 (GRCm39) missense probably benign
R1784:Ro60 UTSW 1 143,635,752 (GRCm39) missense probably benign
R1785:Ro60 UTSW 1 143,635,752 (GRCm39) missense probably benign
R1785:Ro60 UTSW 1 143,635,772 (GRCm39) missense probably benign
R1857:Ro60 UTSW 1 143,646,488 (GRCm39) missense probably benign 0.00
R2049:Ro60 UTSW 1 143,635,772 (GRCm39) missense probably benign
R2130:Ro60 UTSW 1 143,635,772 (GRCm39) missense probably benign
R2131:Ro60 UTSW 1 143,635,772 (GRCm39) missense probably benign
R2133:Ro60 UTSW 1 143,635,772 (GRCm39) missense probably benign
R2141:Ro60 UTSW 1 143,635,772 (GRCm39) missense probably benign
R2142:Ro60 UTSW 1 143,635,772 (GRCm39) missense probably benign
R2372:Ro60 UTSW 1 143,646,620 (GRCm39) nonsense probably null
R4191:Ro60 UTSW 1 143,646,524 (GRCm39) missense probably benign 0.00
R5520:Ro60 UTSW 1 143,646,509 (GRCm39) missense probably benign
R5821:Ro60 UTSW 1 143,642,503 (GRCm39) missense probably benign 0.09
R7432:Ro60 UTSW 1 143,641,548 (GRCm39) missense probably benign 0.43
R7658:Ro60 UTSW 1 143,646,611 (GRCm39) missense probably damaging 1.00
R8833:Ro60 UTSW 1 143,641,517 (GRCm39) nonsense probably null
R8924:Ro60 UTSW 1 143,641,170 (GRCm39) critical splice donor site probably null
R9079:Ro60 UTSW 1 143,641,519 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTAGCAGGGAAGTGGCTG -3'
(R):5'- AATTAGAGTTCTGAAGAGCACAATC -3'

Sequencing Primer
(F):5'- GGCTGTGTATTTTCAATGAAAACCAC -3'
(R):5'- TTCTGAAGAGCACAATCTATTTACTG -3'
Posted On 2014-12-29