Incidental Mutation 'R2929:Pnmal2'
ID254946
Institutional Source Beutler Lab
Gene Symbol Pnmal2
Ensembl Gene ENSMUSG00000070802
Gene NamePNMA-like 2
SynonymsEG434128
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R2929 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location16944682-16948828 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16946692 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 534 (S534P)
Ref Sequence ENSEMBL: ENSMUSP00000092401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094807]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094807
AA Change: S534P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092401
Gene: ENSMUSG00000070802
AA Change: S534P

DomainStartEndE-ValueType
Pfam:PNMA 1 152 4.1e-36 PFAM
low complexity region 172 196 N/A INTRINSIC
internal_repeat_1 239 296 1.86e-6 PROSPERO
SCOP:d1qbkb_ 309 331 2e-3 SMART
internal_repeat_1 343 402 1.86e-6 PROSPERO
low complexity region 445 454 N/A INTRINSIC
low complexity region 466 475 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 518 551 N/A INTRINSIC
low complexity region 571 596 N/A INTRINSIC
low complexity region 612 636 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik G A 6: 50,574,305 T388I probably benign Het
Cd177 G A 7: 24,754,279 Q396* probably null Het
Cdadc1 A T 14: 59,597,835 M1K probably null Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Cnnm3 T A 1: 36,524,059 F701L possibly damaging Het
Cul7 C G 17: 46,651,600 D52E probably benign Het
Dennd4a T C 9: 64,852,417 V268A possibly damaging Het
Deup1 C T 9: 15,575,188 V399I probably benign Het
Dscam T A 16: 96,685,412 Q1021L possibly damaging Het
Dst A T 1: 34,167,062 K932* probably null Het
Neurl2 T C 2: 164,833,344 N33D possibly damaging Het
Pole2 G A 12: 69,209,938 T271M probably benign Het
Ppfibp2 A G 7: 107,697,651 M191V probably damaging Het
Rad51ap2 A G 12: 11,457,184 Q369R probably benign Het
Rbm45 A G 2: 76,378,419 I300V probably benign Het
Sco1 T A 11: 67,063,922 I251K probably damaging Het
Trove2 G A 1: 143,757,878 A494V possibly damaging Het
Zfp202 T C 9: 40,211,688 V582A possibly damaging Het
Zfp219 T A 14: 52,008,979 E230D probably benign Het
Other mutations in Pnmal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Pnmal2 APN 7 16945163 missense unknown
IGL02023:Pnmal2 APN 7 16945691 missense probably damaging 0.97
FR4737:Pnmal2 UTSW 7 16946006 small deletion probably benign
R0085:Pnmal2 UTSW 7 16945549 missense unknown
R2069:Pnmal2 UTSW 7 16945789 missense probably damaging 0.99
R2151:Pnmal2 UTSW 7 16945912 missense probably benign 0.00
R2321:Pnmal2 UTSW 7 16945565 missense unknown
R3738:Pnmal2 UTSW 7 16946596 missense probably benign 0.00
R3739:Pnmal2 UTSW 7 16946596 missense probably benign 0.00
R5185:Pnmal2 UTSW 7 16945976 missense probably damaging 1.00
R5259:Pnmal2 UTSW 7 16945274 missense unknown
R5908:Pnmal2 UTSW 7 16947043 missense unknown
R5943:Pnmal2 UTSW 7 16946437 missense probably benign 0.25
R6101:Pnmal2 UTSW 7 16946568 missense probably benign 0.20
R6260:Pnmal2 UTSW 7 16946233 missense probably benign 0.03
R6583:Pnmal2 UTSW 7 16945919 missense probably damaging 0.97
R7007:Pnmal2 UTSW 7 16946256 missense possibly damaging 0.68
R7497:Pnmal2 UTSW 7 16944949 start gained probably benign
R8231:Pnmal2 UTSW 7 16946590 missense probably benign 0.01
R8278:Pnmal2 UTSW 7 16946338 missense probably damaging 0.99
RF003:Pnmal2 UTSW 7 16946016 small insertion probably benign
Z1176:Pnmal2 UTSW 7 16946810 missense possibly damaging 0.93
Z1177:Pnmal2 UTSW 7 16946968 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGGCTGCGCAAGATATGG -3'
(R):5'- ATGGTCCTCGGTTGAAACCC -3'

Sequencing Primer
(F):5'- CTGCGCAAGATATGGTGGAAGC -3'
(R):5'- TCTTCTCTGGGGTGACAGCC -3'
Posted On2014-12-29