Incidental Mutation 'R2929:Pnma8b'
ID 254946
Institutional Source Beutler Lab
Gene Symbol Pnma8b
Ensembl Gene ENSMUSG00000070802
Gene Name PNMA family member 8B
Synonyms Pnmal2, EG434128
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R2929 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 16678607-16682753 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 16680617 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 534 (S534P)
Ref Sequence ENSEMBL: ENSMUSP00000092401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094807]
AlphaFold G3X9N3
Predicted Effect possibly damaging
Transcript: ENSMUST00000094807
AA Change: S534P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092401
Gene: ENSMUSG00000070802
AA Change: S534P

DomainStartEndE-ValueType
Pfam:PNMA 1 152 4.1e-36 PFAM
low complexity region 172 196 N/A INTRINSIC
internal_repeat_1 239 296 1.86e-6 PROSPERO
SCOP:d1qbkb_ 309 331 2e-3 SMART
internal_repeat_1 343 402 1.86e-6 PROSPERO
low complexity region 445 454 N/A INTRINSIC
low complexity region 466 475 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 518 551 N/A INTRINSIC
low complexity region 571 596 N/A INTRINSIC
low complexity region 612 636 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd177 G A 7: 24,453,704 (GRCm39) Q396* probably null Het
Cdadc1 A T 14: 59,835,284 (GRCm39) M1K probably null Het
Cdc23 ACC AC 18: 34,770,371 (GRCm39) probably null Het
Cnnm3 T A 1: 36,563,140 (GRCm39) F701L possibly damaging Het
Cul7 C G 17: 46,962,526 (GRCm39) D52E probably benign Het
Dennd4a T C 9: 64,759,699 (GRCm39) V268A possibly damaging Het
Deup1 C T 9: 15,486,484 (GRCm39) V399I probably benign Het
Dscam T A 16: 96,486,612 (GRCm39) Q1021L possibly damaging Het
Dst A T 1: 34,206,143 (GRCm39) K932* probably null Het
Neurl2 T C 2: 164,675,264 (GRCm39) N33D possibly damaging Het
Pole2 G A 12: 69,256,712 (GRCm39) T271M probably benign Het
Ppfibp2 A G 7: 107,296,858 (GRCm39) M191V probably damaging Het
Rad51ap2 A G 12: 11,507,185 (GRCm39) Q369R probably benign Het
Rbm45 A G 2: 76,208,763 (GRCm39) I300V probably benign Het
Ro60 G A 1: 143,633,616 (GRCm39) A494V possibly damaging Het
Sco1 T A 11: 66,954,748 (GRCm39) I251K probably damaging Het
Spmip4 G A 6: 50,551,285 (GRCm39) T388I probably benign Het
Zfp202 T C 9: 40,122,984 (GRCm39) V582A possibly damaging Het
Zfp219 T A 14: 52,246,436 (GRCm39) E230D probably benign Het
Other mutations in Pnma8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Pnma8b APN 7 16,679,088 (GRCm39) missense unknown
IGL02023:Pnma8b APN 7 16,679,616 (GRCm39) missense probably damaging 0.97
FR4737:Pnma8b UTSW 7 16,679,931 (GRCm39) small deletion probably benign
R0085:Pnma8b UTSW 7 16,679,474 (GRCm39) missense unknown
R2069:Pnma8b UTSW 7 16,679,714 (GRCm39) missense probably damaging 0.99
R2151:Pnma8b UTSW 7 16,679,837 (GRCm39) missense probably benign 0.00
R2321:Pnma8b UTSW 7 16,679,490 (GRCm39) missense unknown
R3738:Pnma8b UTSW 7 16,680,521 (GRCm39) missense probably benign 0.00
R3739:Pnma8b UTSW 7 16,680,521 (GRCm39) missense probably benign 0.00
R5185:Pnma8b UTSW 7 16,679,901 (GRCm39) missense probably damaging 1.00
R5259:Pnma8b UTSW 7 16,679,199 (GRCm39) missense unknown
R5908:Pnma8b UTSW 7 16,680,968 (GRCm39) missense unknown
R5943:Pnma8b UTSW 7 16,680,362 (GRCm39) missense probably benign 0.25
R6101:Pnma8b UTSW 7 16,680,493 (GRCm39) missense probably benign 0.20
R6260:Pnma8b UTSW 7 16,680,158 (GRCm39) missense probably benign 0.03
R6583:Pnma8b UTSW 7 16,679,844 (GRCm39) missense probably damaging 0.97
R7007:Pnma8b UTSW 7 16,680,181 (GRCm39) missense possibly damaging 0.68
R7497:Pnma8b UTSW 7 16,678,874 (GRCm39) start gained probably benign
R8231:Pnma8b UTSW 7 16,680,515 (GRCm39) missense probably benign 0.01
R8278:Pnma8b UTSW 7 16,680,263 (GRCm39) missense probably damaging 0.99
R8685:Pnma8b UTSW 7 16,679,965 (GRCm39) missense unknown
R9211:Pnma8b UTSW 7 16,679,589 (GRCm39) missense unknown
R9236:Pnma8b UTSW 7 16,679,964 (GRCm39) missense unknown
R9245:Pnma8b UTSW 7 16,680,843 (GRCm39) missense probably benign 0.19
R9267:Pnma8b UTSW 7 16,679,159 (GRCm39) missense unknown
RF003:Pnma8b UTSW 7 16,679,941 (GRCm39) small insertion probably benign
Z1176:Pnma8b UTSW 7 16,680,735 (GRCm39) missense possibly damaging 0.93
Z1177:Pnma8b UTSW 7 16,680,893 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TTGGCTGCGCAAGATATGG -3'
(R):5'- ATGGTCCTCGGTTGAAACCC -3'

Sequencing Primer
(F):5'- CTGCGCAAGATATGGTGGAAGC -3'
(R):5'- TCTTCTCTGGGGTGACAGCC -3'
Posted On 2014-12-29