Incidental Mutation 'R2929:Deup1'
ID254949
Institutional Source Beutler Lab
Gene Symbol Deup1
Ensembl Gene ENSMUSG00000039977
Gene Namedeuterosome assembly protein 1
SynonymsCcdc67, 4933401K09Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2929 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location15559864-15627933 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 15575188 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 399 (V399I)
Ref Sequence ENSEMBL: ENSMUSP00000111256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045513] [ENSMUST00000115592] [ENSMUST00000115593]
Predicted Effect probably benign
Transcript: ENSMUST00000045513
AA Change: V493I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039912
Gene: ENSMUSG00000039977
AA Change: V493I

DomainStartEndE-ValueType
Pfam:CEP63 11 279 7.7e-92 PFAM
low complexity region 286 299 N/A INTRINSIC
coiled coil region 353 397 N/A INTRINSIC
coiled coil region 555 586 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115592
AA Change: V399I

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000111255
Gene: ENSMUSG00000039977
AA Change: V399I

DomainStartEndE-ValueType
coiled coil region 29 59 N/A INTRINSIC
coiled coil region 166 196 N/A INTRINSIC
coiled coil region 226 277 N/A INTRINSIC
low complexity region 286 299 N/A INTRINSIC
coiled coil region 461 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115593
AA Change: V399I

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000111256
Gene: ENSMUSG00000039977
AA Change: V399I

DomainStartEndE-ValueType
coiled coil region 29 59 N/A INTRINSIC
coiled coil region 166 196 N/A INTRINSIC
coiled coil region 226 277 N/A INTRINSIC
low complexity region 286 299 N/A INTRINSIC
coiled coil region 461 492 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137164
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik G A 6: 50,574,305 T388I probably benign Het
Cd177 G A 7: 24,754,279 Q396* probably null Het
Cdadc1 A T 14: 59,597,835 M1K probably null Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Cnnm3 T A 1: 36,524,059 F701L possibly damaging Het
Cul7 C G 17: 46,651,600 D52E probably benign Het
Dennd4a T C 9: 64,852,417 V268A possibly damaging Het
Dscam T A 16: 96,685,412 Q1021L possibly damaging Het
Dst A T 1: 34,167,062 K932* probably null Het
Neurl2 T C 2: 164,833,344 N33D possibly damaging Het
Pnmal2 T C 7: 16,946,692 S534P possibly damaging Het
Pole2 G A 12: 69,209,938 T271M probably benign Het
Ppfibp2 A G 7: 107,697,651 M191V probably damaging Het
Rad51ap2 A G 12: 11,457,184 Q369R probably benign Het
Rbm45 A G 2: 76,378,419 I300V probably benign Het
Sco1 T A 11: 67,063,922 I251K probably damaging Het
Trove2 G A 1: 143,757,878 A494V possibly damaging Het
Zfp202 T C 9: 40,211,688 V582A possibly damaging Het
Zfp219 T A 14: 52,008,979 E230D probably benign Het
Other mutations in Deup1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Deup1 APN 9 15561370 missense probably damaging 0.96
IGL00927:Deup1 APN 9 15610671 splice site probably benign
IGL00946:Deup1 APN 9 15561238 missense possibly damaging 0.62
IGL02458:Deup1 APN 9 15592360 missense probably benign 0.02
IGL02567:Deup1 APN 9 15575283 missense probably damaging 1.00
IGL03089:Deup1 APN 9 15607800 missense possibly damaging 0.62
IGL03220:Deup1 APN 9 15592411 missense probably benign 0.38
IGL03147:Deup1 UTSW 9 15610614 missense probably damaging 0.99
PIT4468001:Deup1 UTSW 9 15564005 missense possibly damaging 0.79
R0035:Deup1 UTSW 9 15599821 missense possibly damaging 0.89
R0035:Deup1 UTSW 9 15599821 missense possibly damaging 0.89
R0324:Deup1 UTSW 9 15582533 missense probably benign 0.01
R0539:Deup1 UTSW 9 15582597 missense possibly damaging 0.51
R0835:Deup1 UTSW 9 15599751 missense probably damaging 1.00
R1666:Deup1 UTSW 9 15575191 missense possibly damaging 0.92
R2212:Deup1 UTSW 9 15599843 missense probably benign 0.00
R2237:Deup1 UTSW 9 15575301 missense probably damaging 1.00
R2238:Deup1 UTSW 9 15575301 missense probably damaging 1.00
R2423:Deup1 UTSW 9 15592458 nonsense probably null
R3890:Deup1 UTSW 9 15599713 missense probably damaging 1.00
R3892:Deup1 UTSW 9 15599713 missense probably damaging 1.00
R4941:Deup1 UTSW 9 15588027 missense probably benign
R4959:Deup1 UTSW 9 15612014 nonsense probably null
R4960:Deup1 UTSW 9 15600968 missense possibly damaging 0.87
R4968:Deup1 UTSW 9 15592428 missense probably damaging 0.99
R4973:Deup1 UTSW 9 15612014 nonsense probably null
R5195:Deup1 UTSW 9 15575191 missense possibly damaging 0.92
R5231:Deup1 UTSW 9 15575199 missense probably damaging 0.96
R5470:Deup1 UTSW 9 15582620 splice site probably null
R5931:Deup1 UTSW 9 15561322 missense possibly damaging 0.55
R6049:Deup1 UTSW 9 15561256 missense possibly damaging 0.75
R6373:Deup1 UTSW 9 15561342 missense probably damaging 0.99
R6516:Deup1 UTSW 9 15610614 missense probably damaging 0.99
R7948:Deup1 UTSW 9 15610648 missense possibly damaging 0.76
R8373:Deup1 UTSW 9 15592375 missense possibly damaging 0.80
R8725:Deup1 UTSW 9 15592425 missense probably damaging 1.00
Z1177:Deup1 UTSW 9 15600903 missense probably null 1.00
Z1177:Deup1 UTSW 9 15607832 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGCAATTGCCAGCCTGTAC -3'
(R):5'- GTTCCATAAACGTCCACTCAGTG -3'

Sequencing Primer
(F):5'- GCCAGCCTGTACTTTTTACAAAACAG -3'
(R):5'- TGAGAACGAAAGACTCCG -3'
Posted On2014-12-29