Incidental Mutation 'R0318:Srp72'
ID25495
Institutional Source Beutler Lab
Gene Symbol Srp72
Ensembl Gene ENSMUSG00000036323
Gene Namesignal recognition particle 72
Synonyms72kDa, 5730576P14Rik
MMRRC Submission 038528-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R0318 (G1)
Quality Score224
Status Not validated
Chromosome5
Chromosomal Location76974683-76999937 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76984200 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 242 (T242I)
Ref Sequence ENSEMBL: ENSMUSP00000098648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101087] [ENSMUST00000120550]
Predicted Effect probably benign
Transcript: ENSMUST00000101087
AA Change: T242I

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000098648
Gene: ENSMUSG00000036323
AA Change: T242I

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:TPR_9 19 70 2.7e-2 PFAM
Pfam:SRP_TPR_like 30 157 5.5e-25 PFAM
Pfam:TPR_8 176 208 2.3e-3 PFAM
Pfam:TPR_1 226 259 2.4e-4 PFAM
Pfam:TPR_2 226 259 4.9e-5 PFAM
Pfam:TPR_8 226 259 1.1e-2 PFAM
Pfam:TPR_9 412 490 1.3e-3 PFAM
Pfam:SRP72 531 588 6.2e-26 PFAM
low complexity region 630 639 N/A INTRINSIC
low complexity region 647 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120550
SMART Domains Protein: ENSMUSP00000113312
Gene: ENSMUSG00000036323

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:TPR_9 19 72 2.5e-2 PFAM
Blast:TPR 109 142 2e-11 BLAST
Blast:TPR 176 209 5e-10 BLAST
Pfam:TPR_6 280 310 2.5e-3 PFAM
Pfam:TPR_9 351 429 1.4e-3 PFAM
Pfam:SRP72 465 527 5.8e-24 PFAM
low complexity region 569 578 N/A INTRINSIC
low complexity region 586 607 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150661
Meta Mutation Damage Score 0.0928 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.4%
  • 20x: 86.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 72 kDa subunit of the signal recognition particle (SRP), a ribonucleoprotein complex that mediates the targeting of secretory proteins to the endoplasmic reticulum (ER). The SRP complex consists of a 7S RNA and 6 protein subunits: SRP9, SRP14, SRP19, SRP54, SRP68, and SRP72, that are bound to the 7S RNA as monomers or heterodimers. SRP has at least 3 distinct functions that can be associated with the protein subunits: signal recognition, translational arrest, and ER membrane targeting by interaction with the docking protein. Mutations in this gene are associated with familial bone marrow failure. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,974 L79Q probably damaging Het
Add1 T C 5: 34,625,340 V130A probably damaging Het
Ankrd23 G T 1: 36,534,072 T73K probably benign Het
BC005561 T C 5: 104,517,753 F47S probably benign Het
Blk A G 14: 63,374,197 Y430H probably damaging Het
C3 C T 17: 57,224,709 V272M probably damaging Het
Cerk C T 15: 86,151,565 A254T possibly damaging Het
Ces2a G A 8: 104,740,824 A494T probably damaging Het
Cfap46 T C 7: 139,654,566 Y258C probably damaging Het
Chaf1a C T 17: 56,062,227 T486I possibly damaging Het
Colec12 A G 18: 9,848,446 N208S possibly damaging Het
Coro7 T A 16: 4,675,807 H63L probably benign Het
Cps1 T A 1: 67,177,014 W833R probably damaging Het
Csmd3 A T 15: 47,659,153 W2707R probably damaging Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Ddx50 A T 10: 62,642,837 I190K probably damaging Het
Dnmt3l G A 10: 78,055,055 V264M probably damaging Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Fam163a A G 1: 156,079,969 C26R probably damaging Het
Fam83h A G 15: 76,003,629 S620P probably benign Het
Fcna A G 2: 25,625,059 S263P probably benign Het
Fnip2 A T 3: 79,512,378 S165R probably damaging Het
Fpr-rs3 T C 17: 20,624,148 T244A probably benign Het
Gpr152 T C 19: 4,143,542 S361P possibly damaging Het
Grm5 A T 7: 87,602,967 I142L probably damaging Het
Gucy2g A G 19: 55,237,798 S229P probably benign Het
Htr7 C T 19: 35,969,486 G376D probably damaging Het
Irgc1 T C 7: 24,432,471 D307G probably benign Het
Irs1 A T 1: 82,288,660 S612T probably benign Het
Maml2 C T 9: 13,620,594 T368I probably damaging Het
Mapkapk2 A G 1: 131,097,335 V64A probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Nptx1 C T 11: 119,542,541 E411K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr995 C A 2: 85,438,237 R307M possibly damaging Het
Pcgf5 A T 19: 36,412,190 K22N possibly damaging Het
Psmd9 C A 5: 123,234,649 A65E possibly damaging Het
Sh3bp1 A G 15: 78,911,707 T679A probably damaging Het
Sipa1l2 G A 8: 125,447,697 P1281S possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc25a24 A G 3: 109,157,000 M222V probably benign Het
Smg9 T C 7: 24,420,888 F429S possibly damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Sorl1 T A 9: 42,081,954 Y258F probably damaging Het
Stc1 A T 14: 69,038,418 Q220L probably damaging Het
Tas2r122 T C 6: 132,711,832 T33A possibly damaging Het
Tbc1d10b A G 7: 127,199,034 L645P probably damaging Het
Timd4 T A 11: 46,837,071 H272Q probably benign Het
Ttll5 T G 12: 85,876,594 probably null Het
Veph1 G T 3: 66,057,259 S783Y probably damaging Het
Vmn1r230 T C 17: 20,846,816 L89S possibly damaging Het
Xcr1 A G 9: 123,856,154 V165A possibly damaging Het
Zfp286 T C 11: 62,784,962 D58G probably damaging Het
Zfyve26 C T 12: 79,276,281 R897H probably damaging Het
Other mutations in Srp72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Srp72 APN 5 76984176 missense probably damaging 1.00
IGL00915:Srp72 APN 5 76978613 nonsense probably null
IGL02731:Srp72 APN 5 76994215 missense probably damaging 0.98
PIT4468001:Srp72 UTSW 5 76994206 missense probably benign
R0009:Srp72 UTSW 5 76987885 missense probably damaging 0.98
R1645:Srp72 UTSW 5 76998278 missense probably benign 0.05
R1678:Srp72 UTSW 5 76980307 missense probably damaging 1.00
R1682:Srp72 UTSW 5 76987870 missense possibly damaging 0.95
R2037:Srp72 UTSW 5 76976491 missense probably damaging 1.00
R2364:Srp72 UTSW 5 76984362 missense probably benign 0.00
R2876:Srp72 UTSW 5 76995920 splice site probably benign
R4072:Srp72 UTSW 5 76998251 missense probably benign 0.24
R4073:Srp72 UTSW 5 76998251 missense probably benign 0.24
R4074:Srp72 UTSW 5 76998251 missense probably benign 0.24
R4638:Srp72 UTSW 5 76990295 missense probably benign 0.00
R4803:Srp72 UTSW 5 76984384 missense probably damaging 0.97
R4864:Srp72 UTSW 5 76984162 missense probably benign 0.35
R5188:Srp72 UTSW 5 76974751 missense possibly damaging 0.54
R5217:Srp72 UTSW 5 76980528 missense probably damaging 1.00
R5459:Srp72 UTSW 5 76984338 missense probably benign 0.16
R5616:Srp72 UTSW 5 76987934 missense probably damaging 1.00
R6460:Srp72 UTSW 5 76987991 missense probably damaging 1.00
R6595:Srp72 UTSW 5 76984200 missense probably benign 0.27
R6959:Srp72 UTSW 5 76994223 missense possibly damaging 0.91
R6986:Srp72 UTSW 5 76994876 missense probably benign 0.16
R7674:Srp72 UTSW 5 76974826 missense probably damaging 0.98
Z1177:Srp72 UTSW 5 76998353 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAATTCTCAAAACTGAGTCTCAGG -3'
(R):5'- GGCACCCTCCAAAAGTTTAGCCTC -3'

Sequencing Primer
(F):5'- GGAAGATTCCTGAAGTTACATGAG -3'
(R):5'- CTGGGATAATGACGTTCTCAGC -3'
Posted On2013-04-16