Mutagenetix > Incidental Mutation

Incidental Mutation 'R2929:Pole2'

254956

Institutional Source

Beutler Lab

Gene Symbol

Pole2

Ensembl Gene

ENSMUSG00000020974

Gene Name

polymerase (DNA directed), epsilon 2 (p59 subunit)

Synonyms

DNA polymerase epsilon small subunit

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2929 (G1)

Quality Score

222

Status

Not validated

Chromosome

Chromosomal Location

69201773-69228195 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 69209938 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 271 (T271M)

Ref Sequence

ENSEMBL: ENSMUSP00000152262 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021359] [ENSMUST00000221411]

AlphaFold

O54956

Predicted Effect

probably benign
Transcript: ENSMUST00000021359
AA Change: T271M

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000021359
Gene: ENSMUSG00000020974
AA Change: T271M

Domain	Start	End	E-Value	Type
Pfam:Dpoe2NT	2	74	1.9e-32	PFAM
Pfam:DNA_pol_E_B	287	489	1.4e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000221411
AA Change: T271M

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221806

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA polymerase epsilon, which is involved in DNA repair and replication, is composed of a large catalytic subunit and a small accessory subunit. The protein encoded by this gene represents the small subunit (B). Defects in this gene have been linked to colorectal cancer and to combined immunodeficiency. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921507P07Rik	G	A	6: 50,574,305	T388I	probably benign	Het
Cd177	G	A	7: 24,754,279	Q396*	probably null	Het
Cdadc1	A	T	14: 59,597,835	M1K	probably null	Het
Cdc23	ACC	AC	18: 34,637,318		probably null	Het
Cnnm3	T	A	1: 36,524,059	F701L	possibly damaging	Het
Cul7	C	G	17: 46,651,600	D52E	probably benign	Het
Dennd4a	T	C	9: 64,852,417	V268A	possibly damaging	Het
Deup1	C	T	9: 15,575,188	V399I	probably benign	Het
Dscam	T	A	16: 96,685,412	Q1021L	possibly damaging	Het
Dst	A	T	1: 34,167,062	K932*	probably null	Het
Neurl2	T	C	2: 164,833,344	N33D	possibly damaging	Het
Pnmal2	T	C	7: 16,946,692	S534P	possibly damaging	Het
Ppfibp2	A	G	7: 107,697,651	M191V	probably damaging	Het
Rad51ap2	A	G	12: 11,457,184	Q369R	probably benign	Het
Rbm45	A	G	2: 76,378,419	I300V	probably benign	Het
Sco1	T	A	11: 67,063,922	I251K	probably damaging	Het
Trove2	G	A	1: 143,757,878	A494V	possibly damaging	Het
Zfp202	T	C	9: 40,211,688	V582A	possibly damaging	Het
Zfp219	T	A	14: 52,008,979	E230D	probably benign	Het

Other mutations in Pole2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00930:Pole2	APN	12	69226445	splice site	probably benign
IGL00940:Pole2	APN	12	69215360	missense	probably damaging	1.00
IGL01593:Pole2	APN	12	69223099	splice site	probably null
IGL01609:Pole2	APN	12	69207857	critical splice donor site	probably null
IGL01717:Pole2	APN	12	69213849	missense	probably damaging	1.00
IGL02168:Pole2	APN	12	69201886	unclassified	probably benign
IGL02208:Pole2	APN	12	69223162	missense	possibly damaging	0.91
IGL02966:Pole2	APN	12	69209875	missense	probably damaging	1.00
PIT4504001:Pole2	UTSW	12	69209985	nonsense	probably null
R0069:Pole2	UTSW	12	69209887	missense	probably damaging	1.00
R0069:Pole2	UTSW	12	69209887	missense	probably damaging	1.00
R0396:Pole2	UTSW	12	69222386	splice site	probably benign
R0574:Pole2	UTSW	12	69211457	splice site	probably benign
R0620:Pole2	UTSW	12	69209879	missense	probably damaging	1.00
R0685:Pole2	UTSW	12	69211413	missense	probably damaging	0.98
R0791:Pole2	UTSW	12	69207929	missense	probably benign	0.06
R1452:Pole2	UTSW	12	69207929	missense	probably benign	0.06
R1453:Pole2	UTSW	12	69207929	missense	probably benign	0.06
R1455:Pole2	UTSW	12	69207929	missense	probably benign	0.06
R1912:Pole2	UTSW	12	69209990	missense	probably damaging	0.99
R2067:Pole2	UTSW	12	69228152	missense	probably benign	0.01
R3016:Pole2	UTSW	12	69222062	missense	probably benign	0.14
R4504:Pole2	UTSW	12	69222468	missense	probably benign	0.00
R4765:Pole2	UTSW	12	69222052	missense	possibly damaging	0.49
R4790:Pole2	UTSW	12	69226365	missense	probably benign	0.00
R4896:Pole2	UTSW	12	69223150	missense	probably damaging	0.97
R6998:Pole2	UTSW	12	69213906	missense	possibly damaging	0.82
R7257:Pole2	UTSW	12	69202910	missense	probably damaging	1.00
R7535:Pole2	UTSW	12	69222429	missense	probably benign	0.10
R7841:Pole2	UTSW	12	69204258	missense	probably damaging	1.00
R8437:Pole2	UTSW	12	69204187	nonsense	probably null
R8506:Pole2	UTSW	12	69208960	missense	probably benign
R9467:Pole2	UTSW	12	69208945	missense	probably benign	0.40
R9494:Pole2	UTSW	12	69202957	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- GCTTTAACTGTGAAAGCTTTGGC -3'
(R):5'- AGGCAACATGTTTCATCTCTGG -3'

Sequencing Primer
(F):5'- GTCTCAGGTTCCCATGTAACAGG -3'
(R):5'- GGCAACATGTTTCATCTCTGGAATAC -3'

Posted On

2014-12-29