Incidental Mutation 'R2929:Pole2'
ID 254956
Institutional Source Beutler Lab
Gene Symbol Pole2
Ensembl Gene ENSMUSG00000020974
Gene Name polymerase (DNA directed), epsilon 2 (p59 subunit)
Synonyms DNA polymerase epsilon small subunit
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2929 (G1)
Quality Score 222
Status Not validated
Chromosome 12
Chromosomal Location 69248547-69274969 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 69256712 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 271 (T271M)
Ref Sequence ENSEMBL: ENSMUSP00000152262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021359] [ENSMUST00000221411]
AlphaFold O54956
Predicted Effect probably benign
Transcript: ENSMUST00000021359
AA Change: T271M

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000021359
Gene: ENSMUSG00000020974
AA Change: T271M

DomainStartEndE-ValueType
Pfam:Dpoe2NT 2 74 1.9e-32 PFAM
Pfam:DNA_pol_E_B 287 489 1.4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221411
AA Change: T271M

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221806
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA polymerase epsilon, which is involved in DNA repair and replication, is composed of a large catalytic subunit and a small accessory subunit. The protein encoded by this gene represents the small subunit (B). Defects in this gene have been linked to colorectal cancer and to combined immunodeficiency. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd177 G A 7: 24,453,704 (GRCm39) Q396* probably null Het
Cdadc1 A T 14: 59,835,284 (GRCm39) M1K probably null Het
Cdc23 ACC AC 18: 34,770,371 (GRCm39) probably null Het
Cnnm3 T A 1: 36,563,140 (GRCm39) F701L possibly damaging Het
Cul7 C G 17: 46,962,526 (GRCm39) D52E probably benign Het
Dennd4a T C 9: 64,759,699 (GRCm39) V268A possibly damaging Het
Deup1 C T 9: 15,486,484 (GRCm39) V399I probably benign Het
Dscam T A 16: 96,486,612 (GRCm39) Q1021L possibly damaging Het
Dst A T 1: 34,206,143 (GRCm39) K932* probably null Het
Neurl2 T C 2: 164,675,264 (GRCm39) N33D possibly damaging Het
Pnma8b T C 7: 16,680,617 (GRCm39) S534P possibly damaging Het
Ppfibp2 A G 7: 107,296,858 (GRCm39) M191V probably damaging Het
Rad51ap2 A G 12: 11,507,185 (GRCm39) Q369R probably benign Het
Rbm45 A G 2: 76,208,763 (GRCm39) I300V probably benign Het
Ro60 G A 1: 143,633,616 (GRCm39) A494V possibly damaging Het
Sco1 T A 11: 66,954,748 (GRCm39) I251K probably damaging Het
Spmip4 G A 6: 50,551,285 (GRCm39) T388I probably benign Het
Zfp202 T C 9: 40,122,984 (GRCm39) V582A possibly damaging Het
Zfp219 T A 14: 52,246,436 (GRCm39) E230D probably benign Het
Other mutations in Pole2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Pole2 APN 12 69,273,219 (GRCm39) splice site probably benign
IGL00940:Pole2 APN 12 69,262,134 (GRCm39) missense probably damaging 1.00
IGL01593:Pole2 APN 12 69,269,873 (GRCm39) splice site probably null
IGL01609:Pole2 APN 12 69,254,631 (GRCm39) critical splice donor site probably null
IGL01717:Pole2 APN 12 69,260,623 (GRCm39) missense probably damaging 1.00
IGL02168:Pole2 APN 12 69,248,660 (GRCm39) unclassified probably benign
IGL02208:Pole2 APN 12 69,269,936 (GRCm39) missense possibly damaging 0.91
IGL02966:Pole2 APN 12 69,256,649 (GRCm39) missense probably damaging 1.00
PIT4504001:Pole2 UTSW 12 69,256,759 (GRCm39) nonsense probably null
R0069:Pole2 UTSW 12 69,256,661 (GRCm39) missense probably damaging 1.00
R0069:Pole2 UTSW 12 69,256,661 (GRCm39) missense probably damaging 1.00
R0396:Pole2 UTSW 12 69,269,160 (GRCm39) splice site probably benign
R0574:Pole2 UTSW 12 69,258,231 (GRCm39) splice site probably benign
R0620:Pole2 UTSW 12 69,256,653 (GRCm39) missense probably damaging 1.00
R0685:Pole2 UTSW 12 69,258,187 (GRCm39) missense probably damaging 0.98
R0791:Pole2 UTSW 12 69,254,703 (GRCm39) missense probably benign 0.06
R1452:Pole2 UTSW 12 69,254,703 (GRCm39) missense probably benign 0.06
R1453:Pole2 UTSW 12 69,254,703 (GRCm39) missense probably benign 0.06
R1455:Pole2 UTSW 12 69,254,703 (GRCm39) missense probably benign 0.06
R1912:Pole2 UTSW 12 69,256,764 (GRCm39) missense probably damaging 0.99
R2067:Pole2 UTSW 12 69,274,926 (GRCm39) missense probably benign 0.01
R3016:Pole2 UTSW 12 69,268,836 (GRCm39) missense probably benign 0.14
R4504:Pole2 UTSW 12 69,269,242 (GRCm39) missense probably benign 0.00
R4765:Pole2 UTSW 12 69,268,826 (GRCm39) missense possibly damaging 0.49
R4790:Pole2 UTSW 12 69,273,139 (GRCm39) missense probably benign 0.00
R4896:Pole2 UTSW 12 69,269,924 (GRCm39) missense probably damaging 0.97
R6998:Pole2 UTSW 12 69,260,680 (GRCm39) missense possibly damaging 0.82
R7257:Pole2 UTSW 12 69,249,684 (GRCm39) missense probably damaging 1.00
R7535:Pole2 UTSW 12 69,269,203 (GRCm39) missense probably benign 0.10
R7841:Pole2 UTSW 12 69,251,032 (GRCm39) missense probably damaging 1.00
R8437:Pole2 UTSW 12 69,250,961 (GRCm39) nonsense probably null
R8506:Pole2 UTSW 12 69,255,734 (GRCm39) missense probably benign
R9467:Pole2 UTSW 12 69,255,719 (GRCm39) missense probably benign 0.40
R9494:Pole2 UTSW 12 69,249,731 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GCTTTAACTGTGAAAGCTTTGGC -3'
(R):5'- AGGCAACATGTTTCATCTCTGG -3'

Sequencing Primer
(F):5'- GTCTCAGGTTCCCATGTAACAGG -3'
(R):5'- GGCAACATGTTTCATCTCTGGAATAC -3'
Posted On 2014-12-29