Incidental Mutation 'R2932:Lor'
ID 254966
Institutional Source Beutler Lab
Gene Symbol Lor
Ensembl Gene ENSMUSG00000043165
Gene Name loricrin
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R2932 (G1)
Quality Score 117
Status Not validated
Chromosome 3
Chromosomal Location 92080271-92083142 bp(-) (GRCm38)
Type of Mutation small deletion (1 aa in frame mutation)
DNA Base Change (assembly) AGCCGCCGCCGCCGCCGCCGCCGCCGCC to AGCCGCCGCCGCCGCCGCCGCCGCC at 92081878 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000052128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058150]
AlphaFold P18165
Predicted Effect probably benign
Transcript: ENSMUST00000058150
SMART Domains Protein: ENSMUSP00000052128
Gene: ENSMUSG00000043165

DomainStartEndE-ValueType
Pfam:Loricrin 316 438 2.7e-11 PFAM
Pfam:Loricrin 426 486 1.4e-14 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene are runted at birth, have a translucent skin and skin skin barrier defect. The morphological skin phenotype disappears after 4-5 days. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 A G 6: 85,620,562 D1259G possibly damaging Het
Arpp21 T C 9: 112,179,105 D106G probably damaging Het
Atp6v1a A G 16: 44,089,043 S542P probably benign Het
Ccar1 T C 10: 62,776,759 N209S probably benign Het
Ccdc15 G A 9: 37,315,658 T327I probably benign Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Fat3 G A 9: 16,375,944 S761L probably damaging Het
Lrrc1 T A 9: 77,457,439 H153L probably benign Het
Lrrc46 T C 11: 97,041,109 probably benign Het
Mrgprb2 A G 7: 48,552,446 L177S probably benign Het
Mtmr2 A T 9: 13,749,117 probably benign Het
Mtnr1b A T 9: 15,874,324 V46E probably damaging Het
Myo5a A G 9: 75,196,136 E207G possibly damaging Het
Nalcn A G 14: 123,593,018 S137P probably benign Het
Nipal1 A G 5: 72,667,635 I224V possibly damaging Het
Oas1g T G 5: 120,879,143 K283Q probably benign Het
Pex12 T A 11: 83,296,223 M300L probably benign Het
Phldb2 A G 16: 45,748,785 V1237A possibly damaging Het
Rc3h2 C A 2: 37,378,359 V920F probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Other mutations in Lor
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4589:Lor UTSW 3 92081894 frame shift probably null
R4677:Lor UTSW 3 92081743 missense unknown
R5454:Lor UTSW 3 92081482 missense unknown
R5851:Lor UTSW 3 92080539 missense unknown
R6267:Lor UTSW 3 92081812 nonsense probably null
R7219:Lor UTSW 3 92081398 missense unknown
R7430:Lor UTSW 3 92081899 missense unknown
R7780:Lor UTSW 3 92081153 nonsense probably null
R8983:Lor UTSW 3 92081139 missense unknown
RF027:Lor UTSW 3 92081876 small deletion probably benign
RF028:Lor UTSW 3 92081899 frame shift probably null
RF031:Lor UTSW 3 92081876 small deletion probably benign
X0057:Lor UTSW 3 92081878 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ACCACCTCCGGAGTACTTGAC -3'
(R):5'- ATCTGCCACCTTCACAGCG -3'

Sequencing Primer
(F):5'- GAGTACTTGACGCCCCCAC -3'
(R):5'- AGCGTCCTCTTGCTGCTG -3'
Posted On 2014-12-29