Incidental Mutation 'R2932:Mtmr2'
ID254973
Institutional Source Beutler Lab
Gene Symbol Mtmr2
Ensembl Gene ENSMUSG00000031918
Gene Namemyotubularin related protein 2
Synonyms6030445P13Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #R2932 (G1)
Quality Score107
Status Not validated
Chromosome9
Chromosomal Location13748410-13806481 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 13749117 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034396] [ENSMUST00000134674] [ENSMUST00000155679] [ENSMUST00000156801]
Predicted Effect probably benign
Transcript: ENSMUST00000034396
SMART Domains Protein: ENSMUSP00000034396
Gene: ENSMUSG00000031918

DomainStartEndE-ValueType
low complexity region 41 55 N/A INTRINSIC
GRAM 65 139 1.57e-11 SMART
Pfam:Myotub-related 192 529 1.7e-152 PFAM
low complexity region 616 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134530
SMART Domains Protein: ENSMUSP00000121223
Gene: ENSMUSG00000031918

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
PDB:1M7R|B 15 66 5e-15 PDB
Blast:GRAM 43 66 8e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000134674
SMART Domains Protein: ENSMUSP00000121933
Gene: ENSMUSG00000031918

DomainStartEndE-ValueType
PDB:1M7R|B 1 62 2e-9 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136735
Predicted Effect probably benign
Transcript: ENSMUST00000155679
SMART Domains Protein: ENSMUSP00000115906
Gene: ENSMUSG00000031918

DomainStartEndE-ValueType
GRAM 3 67 6.19e-10 SMART
Pfam:Myotub-related 119 459 6.7e-152 PFAM
Pfam:Y_phosphatase 266 370 3.9e-6 PFAM
low complexity region 544 559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156801
SMART Domains Protein: ENSMUSP00000117332
Gene: ENSMUSG00000031918

DomainStartEndE-ValueType
PDB:1M7R|B 1 62 2e-9 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myotubularin family of phosphoinositide lipid phosphatases. The encoded protein possesses phosphatase activity towards phosphatidylinositol-3-phosphate and phosphatidylinositol-3,5-bisphosphate. Mutations in this gene are a cause of Charcot-Marie-Tooth disease type 4B, an autosomal recessive demyelinating neuropathy. Alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mutants develop progressive neuropathy characterized by myelin outfolding and recurrent loops and depletion of spermatids and spermatocytes from the seminiferous epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 A G 6: 85,620,562 D1259G possibly damaging Het
Arpp21 T C 9: 112,179,105 D106G probably damaging Het
Atp6v1a A G 16: 44,089,043 S542P probably benign Het
Ccar1 T C 10: 62,776,759 N209S probably benign Het
Ccdc15 G A 9: 37,315,658 T327I probably benign Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Fat3 G A 9: 16,375,944 S761L probably damaging Het
Lor AGCCGCCGCCGCCGCCGCCGCCGCCGCC AGCCGCCGCCGCCGCCGCCGCCGCC 3: 92,081,878 probably benign Het
Lrrc1 T A 9: 77,457,439 H153L probably benign Het
Lrrc46 T C 11: 97,041,109 probably benign Het
Mrgprb2 A G 7: 48,552,446 L177S probably benign Het
Mtnr1b A T 9: 15,874,324 V46E probably damaging Het
Myo5a A G 9: 75,196,136 E207G possibly damaging Het
Nalcn A G 14: 123,593,018 S137P probably benign Het
Nipal1 A G 5: 72,667,635 I224V possibly damaging Het
Oas1g T G 5: 120,879,143 K283Q probably benign Het
Pex12 T A 11: 83,296,223 M300L probably benign Het
Phldb2 A G 16: 45,748,785 V1237A possibly damaging Het
Rc3h2 C A 2: 37,378,359 V920F probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Other mutations in Mtmr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Mtmr2 APN 9 13785916 missense probably benign 0.45
IGL01328:Mtmr2 APN 9 13801927 nonsense probably null
IGL02305:Mtmr2 APN 9 13795255 missense probably damaging 1.00
IGL03069:Mtmr2 APN 9 13793205 nonsense probably null
PIT4431001:Mtmr2 UTSW 9 13793179 missense probably benign 0.01
R0280:Mtmr2 UTSW 9 13799249 missense probably damaging 1.00
R0636:Mtmr2 UTSW 9 13801913 critical splice acceptor site probably null
R0831:Mtmr2 UTSW 9 13796113 missense probably damaging 0.99
R1202:Mtmr2 UTSW 9 13803452 missense probably benign
R1663:Mtmr2 UTSW 9 13803501 missense probably damaging 1.00
R1679:Mtmr2 UTSW 9 13789077 missense probably damaging 1.00
R2086:Mtmr2 UTSW 9 13799952 missense probably damaging 1.00
R2254:Mtmr2 UTSW 9 13796057 missense possibly damaging 0.49
R2255:Mtmr2 UTSW 9 13796057 missense possibly damaging 0.49
R4172:Mtmr2 UTSW 9 13800062 missense probably damaging 1.00
R4669:Mtmr2 UTSW 9 13795964 missense probably damaging 1.00
R5248:Mtmr2 UTSW 9 13783609 intron probably benign
R5317:Mtmr2 UTSW 9 13793179 missense probably benign 0.01
R5326:Mtmr2 UTSW 9 13788647 missense probably damaging 1.00
R5573:Mtmr2 UTSW 9 13793167 missense probably benign 0.15
R5830:Mtmr2 UTSW 9 13801978 missense probably benign 0.00
R6332:Mtmr2 UTSW 9 13800029 missense probably damaging 0.99
R6638:Mtmr2 UTSW 9 13796133 missense probably damaging 1.00
R6791:Mtmr2 UTSW 9 13805382 missense probably benign 0.02
R7072:Mtmr2 UTSW 9 13788620 missense probably benign 0.00
R7474:Mtmr2 UTSW 9 13799225 missense probably damaging 1.00
R7722:Mtmr2 UTSW 9 13804808 missense probably benign
Z1176:Mtmr2 UTSW 9 13799281 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCACGTATGATCTCACATCACTAC -3'
(R):5'- TTCTCCATGGCGCGAGAAAC -3'

Sequencing Primer
(F):5'- ATGATCTCACATCACTACTTCTAACC -3'
(R):5'- AGAAACTGGAGGCCGCTGC -3'
Posted On2014-12-29