Incidental Mutation 'R2932:Arpp21'
ID254978
Institutional Source Beutler Lab
Gene Symbol Arpp21
Ensembl Gene ENSMUSG00000032503
Gene Namecyclic AMP-regulated phosphoprotein, 21
SynonymsARPP-21, 0710001E13Rik, Tarpp, D9Bwg1012e, R3hdm3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2932 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location112065091-112235938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112179105 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 106 (D106G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035085] [ENSMUST00000070218] [ENSMUST00000111872] [ENSMUST00000159055] [ENSMUST00000159246] [ENSMUST00000159451] [ENSMUST00000160478] [ENSMUST00000161097] [ENSMUST00000161412] [ENSMUST00000162065] [ENSMUST00000162097] [ENSMUST00000162796] [ENSMUST00000164754] [ENSMUST00000172380] [ENSMUST00000178410]
Predicted Effect probably benign
Transcript: ENSMUST00000035085
AA Change: D109G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000035085
Gene: ENSMUSG00000032503
AA Change: D109G

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 282 297 N/A INTRINSIC
low complexity region 348 368 N/A INTRINSIC
low complexity region 459 482 N/A INTRINSIC
low complexity region 490 503 N/A INTRINSIC
low complexity region 642 657 N/A INTRINSIC
low complexity region 662 674 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070218
AA Change: D109G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000069264
Gene: ENSMUSG00000032503
AA Change: D109G

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 302 317 N/A INTRINSIC
low complexity region 368 388 N/A INTRINSIC
low complexity region 479 502 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
low complexity region 662 677 N/A INTRINSIC
low complexity region 682 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111872
AA Change: D109G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000107503
Gene: ENSMUSG00000032503
AA Change: D109G

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 302 317 N/A INTRINSIC
low complexity region 368 388 N/A INTRINSIC
low complexity region 479 502 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
low complexity region 662 677 N/A INTRINSIC
low complexity region 682 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159055
AA Change: D109G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123883
Gene: ENSMUSG00000032503
AA Change: D109G

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159220
Predicted Effect probably benign
Transcript: ENSMUST00000159246
AA Change: D109G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000123715
Gene: ENSMUSG00000032503
AA Change: D109G

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 260 274 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159444
Predicted Effect possibly damaging
Transcript: ENSMUST00000159451
AA Change: D109G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125095
Gene: ENSMUSG00000032503
AA Change: D109G

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 233 248 N/A INTRINSIC
low complexity region 299 319 N/A INTRINSIC
low complexity region 410 433 N/A INTRINSIC
low complexity region 558 569 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159667
Predicted Effect probably damaging
Transcript: ENSMUST00000160240
AA Change: D106G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000160478
SMART Domains Protein: ENSMUSP00000124550
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160741
Predicted Effect possibly damaging
Transcript: ENSMUST00000161097
AA Change: D109G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123937
Gene: ENSMUSG00000032503
AA Change: D109G

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161138
Predicted Effect probably benign
Transcript: ENSMUST00000161412
AA Change: D109G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000125282
Gene: ENSMUSG00000032503
AA Change: D109G

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161467
Predicted Effect probably benign
Transcript: ENSMUST00000162065
AA Change: D109G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000125684
Gene: ENSMUSG00000032503
AA Change: D109G

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 302 317 N/A INTRINSIC
low complexity region 368 388 N/A INTRINSIC
low complexity region 479 502 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
low complexity region 662 677 N/A INTRINSIC
low complexity region 682 694 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162082
Predicted Effect probably benign
Transcript: ENSMUST00000162097
AA Change: D109G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000124502
Gene: ENSMUSG00000032503
AA Change: D109G

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
Pfam:SUZ 244 298 3.4e-15 PFAM
low complexity region 335 350 N/A INTRINSIC
low complexity region 401 421 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 660 675 N/A INTRINSIC
low complexity region 680 692 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162533
Predicted Effect unknown
Transcript: ENSMUST00000162796
AA Change: D109G
SMART Domains Protein: ENSMUSP00000124670
Gene: ENSMUSG00000032503
AA Change: D109G

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164754
AA Change: D109G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000125862
Gene: ENSMUSG00000032503
AA Change: D109G

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
Pfam:SUZ 244 298 3.4e-15 PFAM
low complexity region 335 350 N/A INTRINSIC
low complexity region 401 421 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 660 675 N/A INTRINSIC
low complexity region 680 692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172380
SMART Domains Protein: ENSMUSP00000130558
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178410
SMART Domains Protein: ENSMUSP00000136769
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cAMP-regulated phosphoprotein. The encoded protein is enriched in the caudate nucleus and cerebellar cortex. A similar protein in mouse may be involved in regulating the effects of dopamine in the basal ganglia. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mice are viable and display normal brain anatomy and no obvious behavioral or morphological defects. However, in medium spiny neurons from mutant mice, the ability of both M1 and D2 receptor activation to modulate L-type calcium channel currents is enhanced by nearly 2-fold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 A G 6: 85,620,562 D1259G possibly damaging Het
Atp6v1a A G 16: 44,089,043 S542P probably benign Het
Ccar1 T C 10: 62,776,759 N209S probably benign Het
Ccdc15 G A 9: 37,315,658 T327I probably benign Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Fat3 G A 9: 16,375,944 S761L probably damaging Het
Lor AGCCGCCGCCGCCGCCGCCGCCGCCGCC AGCCGCCGCCGCCGCCGCCGCCGCC 3: 92,081,878 probably benign Het
Lrrc1 T A 9: 77,457,439 H153L probably benign Het
Lrrc46 T C 11: 97,041,109 probably benign Het
Mrgprb2 A G 7: 48,552,446 L177S probably benign Het
Mtmr2 A T 9: 13,749,117 probably benign Het
Mtnr1b A T 9: 15,874,324 V46E probably damaging Het
Myo5a A G 9: 75,196,136 E207G possibly damaging Het
Nalcn A G 14: 123,593,018 S137P probably benign Het
Nipal1 A G 5: 72,667,635 I224V possibly damaging Het
Oas1g T G 5: 120,879,143 K283Q probably benign Het
Pex12 T A 11: 83,296,223 M300L probably benign Het
Phldb2 A G 16: 45,748,785 V1237A possibly damaging Het
Rc3h2 C A 2: 37,378,359 V920F probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Other mutations in Arpp21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Arpp21 APN 9 112176123 missense probably damaging 1.00
IGL02369:Arpp21 APN 9 112119198 missense probably benign
IGL02516:Arpp21 APN 9 112185661 missense probably damaging 1.00
IGL02687:Arpp21 APN 9 112065815 nonsense probably null
IGL02698:Arpp21 APN 9 112185744 utr 5 prime probably benign
IGL02948:Arpp21 APN 9 112176200 missense probably damaging 1.00
R0040:Arpp21 UTSW 9 112147409 splice site probably benign
R0533:Arpp21 UTSW 9 112126505 missense probably benign 0.36
R0636:Arpp21 UTSW 9 112183498 missense probably benign 0.30
R0696:Arpp21 UTSW 9 112183589 splice site probably null
R0707:Arpp21 UTSW 9 112157756 missense probably benign 0.25
R0970:Arpp21 UTSW 9 112136448 splice site probably benign
R1300:Arpp21 UTSW 9 112143374 missense probably damaging 1.00
R1416:Arpp21 UTSW 9 112179129 missense probably damaging 1.00
R1713:Arpp21 UTSW 9 112067169 missense probably damaging 1.00
R1803:Arpp21 UTSW 9 112127398 missense possibly damaging 0.61
R1884:Arpp21 UTSW 9 112143527 missense probably damaging 1.00
R1918:Arpp21 UTSW 9 112119178 splice site probably benign
R1992:Arpp21 UTSW 9 112157793 missense probably damaging 0.97
R2121:Arpp21 UTSW 9 112136670 missense probably damaging 1.00
R3729:Arpp21 UTSW 9 112065979 missense possibly damaging 0.76
R3964:Arpp21 UTSW 9 112065776 missense probably damaging 1.00
R4130:Arpp21 UTSW 9 112155308 intron probably benign
R4131:Arpp21 UTSW 9 112155308 intron probably benign
R4514:Arpp21 UTSW 9 112177677 missense probably damaging 0.99
R4789:Arpp21 UTSW 9 112067292 missense probably benign 0.02
R5138:Arpp21 UTSW 9 112179084 missense probably damaging 1.00
R5218:Arpp21 UTSW 9 112143431 missense probably damaging 1.00
R5371:Arpp21 UTSW 9 112065932 missense probably benign 0.01
R5373:Arpp21 UTSW 9 112067268 missense probably benign
R5407:Arpp21 UTSW 9 112116753 intron probably benign
R5528:Arpp21 UTSW 9 112149353 missense probably benign 0.04
R5957:Arpp21 UTSW 9 112185686 missense probably benign 0.01
R5992:Arpp21 UTSW 9 112143485 nonsense probably null
R6166:Arpp21 UTSW 9 112119198 missense probably benign
R6294:Arpp21 UTSW 9 112127452 missense probably damaging 0.99
R6632:Arpp21 UTSW 9 112127356 nonsense probably null
R6952:Arpp21 UTSW 9 112126482 missense probably damaging 0.98
R7083:Arpp21 UTSW 9 112183544 missense probably benign 0.22
R7089:Arpp21 UTSW 9 112126446 missense probably benign 0.23
X0013:Arpp21 UTSW 9 112179160 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCTGGGCTGTAAACATTG -3'
(R):5'- AGTTCACCGTAAAGGGCAAGTATTC -3'

Sequencing Primer
(F):5'- CCTGGGCTGTAAACATTGGTGTG -3'
(R):5'- GAGGAATCCATACGAACCTCTC -3'
Posted On2014-12-29