Incidental Mutation 'R2935:Rap1gap'
ID254992
Institutional Source Beutler Lab
Gene Symbol Rap1gap
Ensembl Gene ENSMUSG00000041351
Gene NameRap1 GTPase-activating protein
Synonyms1300019I11Rik, 2310004O14Rik, Rap1ga1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2935 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location137664726-137729861 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137724731 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 521 (S521P)
Ref Sequence ENSEMBL: ENSMUSP00000095448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047243] [ENSMUST00000097837] [ENSMUST00000105835] [ENSMUST00000141306]
Predicted Effect probably benign
Transcript: ENSMUST00000047243
AA Change: S554P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000042473
Gene: ENSMUSG00000041351
AA Change: S554P

DomainStartEndE-ValueType
GoLoco 59 81 4.94e-10 SMART
Pfam:Rap_GAP 274 461 1.4e-64 PFAM
low complexity region 485 495 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097837
AA Change: S521P

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000095448
Gene: ENSMUSG00000041351
AA Change: S521P

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
GoLoco 26 48 4.94e-10 SMART
Pfam:Rap_GAP 241 428 1.2e-64 PFAM
low complexity region 452 462 N/A INTRINSIC
low complexity region 597 608 N/A INTRINSIC
low complexity region 647 662 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105835
AA Change: S554P

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101461
Gene: ENSMUSG00000041351
AA Change: S554P

DomainStartEndE-ValueType
GoLoco 59 81 4.94e-10 SMART
Pfam:Rap_GAP 274 455 4.5e-66 PFAM
low complexity region 485 495 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123134
Predicted Effect probably benign
Transcript: ENSMUST00000141306
AA Change: S236P

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000122315
Gene: ENSMUSG00000041351
AA Change: S236P

DomainStartEndE-ValueType
Pfam:Rap_GAP 1 117 1.4e-32 PFAM
low complexity region 141 151 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 362 377 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151601
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type of GTPase-activating-protein (GAP) that down-regulates the activity of the ras-related RAP1 protein. RAP1 acts as a molecular switch by cycling between an inactive GDP-bound form and an active GTP-bound form. The product of this gene, RAP1GAP, promotes the hydrolysis of bound GTP and hence returns RAP1 to the inactive state whereas other proteins, guanine nucleotide exchange factors (GEFs), act as RAP1 activators by facilitating the conversion of RAP1 from the GDP- to the GTP-bound form. In general, ras subfamily proteins, such as RAP1, play key roles in receptor-linked signaling pathways that control cell growth and differentiation. RAP1 plays a role in diverse processes such as cell proliferation, adhesion, differentiation, and embryogenesis. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Adgrl1 T C 8: 83,934,560 I894T probably damaging Het
Cd55 A G 1: 130,452,426 S272P possibly damaging Het
Chek2 T C 5: 110,868,020 V467A probably damaging Het
Cyp11a1 A G 9: 58,016,390 Y126C probably damaging Het
Ddx39 T A 8: 83,720,958 V144D possibly damaging Het
Fbxl19 G A 7: 127,752,260 R304H probably damaging Het
Ide A G 19: 37,325,307 F135L unknown Het
Khdc3 T C 9: 73,103,705 V255A possibly damaging Het
Klk1b22 A G 7: 44,114,722 I25V probably benign Het
Magi2 A AG 5: 20,602,461 probably null Het
Mark2 T C 19: 7,285,889 N204S probably benign Het
Olfr1230 A T 2: 89,297,260 N3K possibly damaging Het
Olfr364-ps1 A G 2: 37,147,111 K300E possibly damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Piezo2 A G 18: 63,146,843 I219T probably damaging Het
Rxrb CGCGGCGGCGGCGGCGGCGGC CGCGGCGGCGGCGGCGGC 17: 34,032,132 probably benign Het
Smchd1 G A 17: 71,411,905 P823L probably damaging Het
Sncaip A G 18: 52,838,032 D8G probably damaging Het
Stau1 G A 2: 166,955,117 T120I probably benign Het
Stxbp5l G T 16: 37,134,189 H920N possibly damaging Het
Thsd7b A G 1: 129,678,087 T522A possibly damaging Het
Other mutations in Rap1gap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Rap1gap APN 4 137716524 missense probably damaging 0.98
IGL01810:Rap1gap APN 4 137716155 missense probably benign 0.07
IGL01944:Rap1gap APN 4 137725620 missense probably damaging 1.00
IGL02117:Rap1gap APN 4 137727044 missense probably damaging 0.98
IGL02271:Rap1gap APN 4 137718006 missense probably damaging 1.00
IGL02272:Rap1gap APN 4 137716566 missense probably damaging 1.00
IGL02590:Rap1gap APN 4 137720300 missense probably damaging 0.98
IGL02626:Rap1gap APN 4 137727053 missense probably benign 0.00
IGL03211:Rap1gap APN 4 137715846 critical splice donor site probably null
R0243:Rap1gap UTSW 4 137719351 missense probably damaging 0.99
R1239:Rap1gap UTSW 4 137717996 missense probably damaging 1.00
R1246:Rap1gap UTSW 4 137712094 missense possibly damaging 0.86
R2264:Rap1gap UTSW 4 137727723 missense probably benign
R3840:Rap1gap UTSW 4 137717447 missense probably damaging 1.00
R3841:Rap1gap UTSW 4 137717447 missense probably damaging 1.00
R4619:Rap1gap UTSW 4 137716111 missense probably damaging 1.00
R4821:Rap1gap UTSW 4 137712129 missense probably damaging 0.99
R4998:Rap1gap UTSW 4 137728284 missense possibly damaging 0.80
R5061:Rap1gap UTSW 4 137720433 critical splice donor site probably null
R5800:Rap1gap UTSW 4 137720377 missense probably benign 0.00
R6259:Rap1gap UTSW 4 137681757 critical splice donor site probably null
R7082:Rap1gap UTSW 4 137718936 missense probably damaging 1.00
R7098:Rap1gap UTSW 4 137716082 splice site probably null
R7234:Rap1gap UTSW 4 137728540 nonsense probably null
R7580:Rap1gap UTSW 4 137719982 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCAGAAAGCACATTTTCTCTCC -3'
(R):5'- GCTCAGTGTCAAATGGAAGTGG -3'

Sequencing Primer
(F):5'- GAAAGCACATTTTCTCTCCTTTCTTG -3'
(R):5'- AAGTGGTTCCTCCTGAGCGTC -3'
Posted On2014-12-29