Incidental Mutation 'R2936:Stbd1'
ID255021
Institutional Source Beutler Lab
Gene Symbol Stbd1
Ensembl Gene ENSMUSG00000047963
Gene Namestarch binding domain 1
SynonymsD530019K15Rik, D5Ertd593e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2936 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location92603041-92606579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 92603260 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 51 (P51L)
Ref Sequence ENSEMBL: ENSMUSP00000054322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050952] [ENSMUST00000060930] [ENSMUST00000200941] [ENSMUST00000202332]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050952
AA Change: P51L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054322
Gene: ENSMUSG00000047963
AA Change: P51L

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
low complexity region 36 68 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
CBM_2 243 334 2.81e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060930
SMART Domains Protein: ENSMUSP00000063050
Gene: ENSMUSG00000050050

DomainStartEndE-ValueType
Pfam:CCDC158 1 1109 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136004
Predicted Effect unknown
Transcript: ENSMUST00000200941
AA Change: P51L
SMART Domains Protein: ENSMUSP00000144305
Gene: ENSMUSG00000047963
AA Change: P51L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 36 68 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000202332
AA Change: P51L
SMART Domains Protein: ENSMUSP00000144467
Gene: ENSMUSG00000047963
AA Change: P51L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 36 68 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,468,448 M121K probably damaging Het
Cacybp A T 1: 160,208,377 probably null Het
Cd6 T C 19: 10,796,322 probably null Het
Cep162 T C 9: 87,227,414 T379A probably benign Het
Gaa T C 11: 119,283,724 V799A probably benign Het
Gm16503 A G 4: 147,541,247 D66G unknown Het
Hspa9 T C 18: 34,948,014 T205A probably damaging Het
Ihh A G 1: 74,946,546 I260T probably damaging Het
Jcad T A 18: 4,675,153 Y972N probably benign Het
Magi2 A AG 5: 20,602,461 probably null Het
Mmp12 A G 9: 7,357,819 Q341R probably benign Het
Nup155 T C 15: 8,143,049 S840P possibly damaging Het
Olfr724 A T 14: 49,960,154 V306E probably benign Het
Papd7 G A 13: 69,502,327 T621I possibly damaging Het
Pde4b C T 4: 102,601,545 A466V probably damaging Het
Pde5a A G 3: 122,794,319 E378G probably damaging Het
Rad54l T C 4: 116,122,879 probably benign Het
Tnfaip3 A G 10: 19,011,609 F56S probably damaging Het
Tnr A C 1: 159,888,362 Y898S probably damaging Het
Trav6n-6 A G 14: 53,132,884 T31A probably benign Het
Other mutations in Stbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02718:Stbd1 APN 5 92603218 missense possibly damaging 0.72
R0830:Stbd1 UTSW 5 92605130 missense probably benign 0.00
R1168:Stbd1 UTSW 5 92604936 missense probably benign 0.19
R4107:Stbd1 UTSW 5 92605280 missense probably benign 0.00
R5849:Stbd1 UTSW 5 92604995 missense probably benign 0.00
R7011:Stbd1 UTSW 5 92605118 nonsense probably null
R7747:Stbd1 UTSW 5 92605557 missense probably damaging 1.00
Z1177:Stbd1 UTSW 5 92603055 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCGGCCAAGAACCTTAAAAG -3'
(R):5'- TCGTACACTGCTCCAAGTG -3'

Sequencing Primer
(F):5'- ACTGGGGCTCGTAGTCTC -3'
(R):5'- AAGGTTCAGTCCGAGGTCG -3'
Posted On2014-12-29