Incidental Mutation 'R2937:Lrrtm1'
ID255063
Institutional Source Beutler Lab
Gene Symbol Lrrtm1
Ensembl Gene ENSMUSG00000060780
Gene Nameleucine rich repeat transmembrane neuronal 1
Synonyms4632401D06Rik
MMRRC Submission 040514-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2937 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location77242689-77257791 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77243652 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 31 (M31L)
Ref Sequence ENSEMBL: ENSMUSP00000124948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020400] [ENSMUST00000075340] [ENSMUST00000159616] [ENSMUST00000159626] [ENSMUST00000160894] [ENSMUST00000161677] [ENSMUST00000161811] [ENSMUST00000161846]
Predicted Effect probably benign
Transcript: ENSMUST00000020400
AA Change: M31L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000020400
Gene: ENSMUSG00000060780
AA Change: M31L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 38 70 1.06e0 SMART
LRR 64 87 5.56e0 SMART
LRR 88 111 1.03e1 SMART
LRR_TYP 112 135 2.71e-2 SMART
LRR_TYP 136 159 1.98e-4 SMART
LRR_TYP 160 183 9.44e-2 SMART
LRR 184 207 6.96e0 SMART
LRR 208 236 1.76e2 SMART
LRR 255 278 4.71e1 SMART
LRR 279 302 1.03e1 SMART
Blast:LRRCT 314 364 4e-13 BLAST
transmembrane domain 428 450 N/A INTRINSIC
low complexity region 467 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075340
SMART Domains Protein: ENSMUSP00000074809
Gene: ENSMUSG00000063063

DomainStartEndE-ValueType
Pfam:Vinculin 18 337 2e-104 PFAM
Pfam:Vinculin 331 866 7.7e-222 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159616
AA Change: M31L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000125207
Gene: ENSMUSG00000060780
AA Change: M31L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 38 70 1.06e0 SMART
LRR 64 87 5.56e0 SMART
LRR 88 111 1.03e1 SMART
LRR_TYP 112 135 2.71e-2 SMART
LRR_TYP 136 159 1.98e-4 SMART
LRR_TYP 160 183 9.44e-2 SMART
LRR 184 207 6.96e0 SMART
LRR 208 236 1.76e2 SMART
LRR 255 278 4.71e1 SMART
LRR 279 302 1.03e1 SMART
Blast:LRRCT 314 364 4e-13 BLAST
transmembrane domain 428 450 N/A INTRINSIC
low complexity region 467 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159626
SMART Domains Protein: ENSMUSP00000124376
Gene: ENSMUSG00000063063

DomainStartEndE-ValueType
Pfam:Vinculin 18 337 3.4e-105 PFAM
Pfam:Vinculin 330 914 6.6e-214 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160894
SMART Domains Protein: ENSMUSP00000124764
Gene: ENSMUSG00000063063

DomainStartEndE-ValueType
Pfam:Vinculin 31 352 2.1e-104 PFAM
Pfam:Vinculin 343 927 4.6e-213 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161677
AA Change: M31L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124373
Gene: ENSMUSG00000060780
AA Change: M31L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 38 70 1.06e0 SMART
LRR 64 87 5.56e0 SMART
LRR 88 111 1.03e1 SMART
LRR_TYP 112 135 2.71e-2 SMART
LRR_TYP 136 159 1.98e-4 SMART
LRR_TYP 160 183 9.44e-2 SMART
LRR 184 207 6.96e0 SMART
LRR 208 236 1.76e2 SMART
LRR 255 278 4.71e1 SMART
LRR 279 302 1.03e1 SMART
Blast:LRRCT 314 364 4e-13 BLAST
transmembrane domain 428 450 N/A INTRINSIC
low complexity region 467 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161811
AA Change: M31L

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124948
Gene: ENSMUSG00000060780
AA Change: M31L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 38 70 1.06e0 SMART
LRR 64 87 5.56e0 SMART
LRR 88 111 1.03e1 SMART
LRR_TYP 112 135 2.71e-2 SMART
LRR_TYP 136 159 1.98e-4 SMART
LRR_TYP 160 183 9.44e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161846
SMART Domains Protein: ENSMUSP00000123714
Gene: ENSMUSG00000063063

DomainStartEndE-ValueType
Pfam:Vinculin 31 350 5.3e-105 PFAM
Pfam:Vinculin 344 879 2.1e-222 PFAM
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (73/73)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with grossly normal brain morphology. Mice homozygous for another knock-out allele exhibit impaired cognitive function and altered hippocampal synapse morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 A G 7: 119,659,127 E481G probably damaging Het
Anks1b C T 10: 90,077,066 T351M probably damaging Het
Arhgap45 T A 10: 80,029,002 M933K probably damaging Het
Asph A C 4: 9,542,314 probably benign Het
Bace2 T C 16: 97,412,188 probably null Het
BC051142 A T 17: 34,421,862 H57L possibly damaging Het
Cacna1b A G 2: 24,606,528 V125A probably benign Het
Cbarp T C 10: 80,131,769 D539G probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdr1 T G X: 61,185,362 D66A unknown Het
Cela3b A G 4: 137,423,263 I208T probably benign Het
Clca3a2 T A 3: 144,813,918 T232S probably benign Het
Col1a2 G A 6: 4,519,882 probably benign Het
Col1a2 A T 6: 4,520,788 Q375L possibly damaging Het
Cpd T C 11: 76,811,859 N561S probably damaging Het
Csn1s1 A T 5: 87,677,136 Q221L possibly damaging Het
Depdc5 G A 5: 32,901,621 probably null Het
Dnah10 T C 5: 124,819,412 probably null Het
Dsg2 T C 18: 20,579,128 F107S probably damaging Het
Dthd1 A G 5: 62,842,957 I541V probably benign Het
Eml6 G A 11: 29,833,049 probably benign Het
Fermt2 A C 14: 45,504,491 probably null Het
Gimap8 A T 6: 48,658,796 R498S possibly damaging Het
Glis1 A G 4: 107,632,291 N692D possibly damaging Het
Grtp1 G A 8: 13,189,755 probably benign Het
Hecw1 G T 13: 14,245,836 Q1001K possibly damaging Het
Hydin T C 8: 110,404,295 V606A possibly damaging Het
Krt33b T A 11: 100,024,009 N388I probably benign Het
Lipf T C 19: 33,973,038 Y277H probably damaging Het
Lmod1 A G 1: 135,363,916 K170E probably benign Het
Maats1 A T 16: 38,311,038 I471N possibly damaging Het
Man1c1 A G 4: 134,702,952 I173T possibly damaging Het
Med17 T C 9: 15,275,891 K196E probably damaging Het
Mmp25 T A 17: 23,644,791 I22F probably benign Het
Nrg3 T A 14: 38,371,008 N540I possibly damaging Het
Nsun5 C T 5: 135,375,463 Q375* probably null Het
Olfr584 T A 7: 103,086,341 H269Q probably benign Het
Olfr600 T C 7: 103,346,065 M288V probably benign Het
Pcdh1 G T 18: 38,189,762 A1006E probably benign Het
Pdss1 T A 2: 22,906,787 probably null Het
Plaa G A 4: 94,569,459 A758V probably damaging Het
Prl6a1 T A 13: 27,315,320 W24R probably damaging Het
Ptk7 T C 17: 46,572,550 H863R probably damaging Het
Rbm10 T C X: 20,647,695 L429P possibly damaging Het
Rhou T C 8: 123,661,141 I204T possibly damaging Het
Serpind1 G T 16: 17,337,108 M266I probably benign Het
Sgcg A T 14: 61,229,625 F175L probably damaging Het
Slc2a2 T G 3: 28,718,771 C238G probably damaging Het
Slc39a8 A G 3: 135,886,823 M420V probably benign Het
Slc7a9 C A 7: 35,463,742 Y457* probably null Het
Smpd3 C T 8: 106,264,820 R367H probably damaging Het
Sntb2 T C 8: 106,936,097 V99A probably benign Het
Specc1l T G 10: 75,259,131 I796R probably damaging Het
Stfa2l1 G T 16: 36,159,946 V29F probably damaging Het
Synrg T C 11: 83,994,354 F455S probably damaging Het
Tap2 T C 17: 34,212,354 V422A possibly damaging Het
Tcf7 A T 11: 52,282,783 probably null Het
Tcp10a A G 17: 7,329,774 Y110C probably damaging Het
Thoc1 T A 18: 9,959,255 S43R probably damaging Het
Tlr1 A G 5: 64,925,908 V442A probably damaging Het
Tmub1 A G 5: 24,445,924 *261Q probably null Het
Trpc3 G A 3: 36,634,383 R836* probably null Het
Ube2u T C 4: 100,524,298 S185P possibly damaging Het
Vamp5 A G 6: 72,369,340 V91A probably benign Het
Vcp A G 4: 42,980,846 Y755H probably damaging Het
Vmn1r35 A T 6: 66,678,966 M73K possibly damaging Het
Vmn2r12 C T 5: 109,091,531 E389K probably damaging Het
Wdfy3 A T 5: 101,944,122 F450L probably benign Het
Xpo4 G T 14: 57,604,440 Q473K probably benign Het
Xpo7 A G 14: 70,671,690 I797T probably damaging Het
Xylt1 C A 7: 117,634,784 Q513K probably benign Het
Zfp229 T C 17: 21,745,503 F238S probably damaging Het
Other mutations in Lrrtm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Lrrtm1 APN 6 77244063 missense probably benign 0.00
IGL01011:Lrrtm1 APN 6 77244235 unclassified probably null
IGL01125:Lrrtm1 APN 6 77244453 missense probably damaging 1.00
IGL01924:Lrrtm1 APN 6 77244186 missense possibly damaging 0.81
IGL02508:Lrrtm1 APN 6 77244591 missense probably damaging 1.00
IGL03005:Lrrtm1 APN 6 77244156 missense probably damaging 1.00
IGL03076:Lrrtm1 APN 6 77244585 missense probably damaging 1.00
R0077:Lrrtm1 UTSW 6 77243872 missense probably damaging 1.00
R0540:Lrrtm1 UTSW 6 77244628 missense probably damaging 1.00
R0607:Lrrtm1 UTSW 6 77244628 missense probably damaging 1.00
R0927:Lrrtm1 UTSW 6 77244860 missense probably damaging 1.00
R1742:Lrrtm1 UTSW 6 77244091 missense probably damaging 1.00
R1762:Lrrtm1 UTSW 6 77244697 missense probably benign
R1933:Lrrtm1 UTSW 6 77244966 intron probably null
R1934:Lrrtm1 UTSW 6 77244966 intron probably null
R2180:Lrrtm1 UTSW 6 77244346 missense probably damaging 1.00
R2267:Lrrtm1 UTSW 6 77244013 missense probably damaging 0.97
R2914:Lrrtm1 UTSW 6 77244979 missense probably damaging 0.99
R2938:Lrrtm1 UTSW 6 77243652 missense probably benign 0.03
R4604:Lrrtm1 UTSW 6 77244144 missense probably damaging 1.00
R4908:Lrrtm1 UTSW 6 77244678 missense probably benign 0.01
R4910:Lrrtm1 UTSW 6 77244901 missense probably damaging 1.00
R5739:Lrrtm1 UTSW 6 77244889 missense probably damaging 0.99
R6604:Lrrtm1 UTSW 6 77244238 missense possibly damaging 0.70
R6845:Lrrtm1 UTSW 6 77243881 missense probably benign 0.02
R7048:Lrrtm1 UTSW 6 77244169 missense probably damaging 1.00
R7203:Lrrtm1 UTSW 6 77243601 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCTCCCTCGGAATAAAATATGC -3'
(R):5'- GCACCGAGCAGATGTGATTG -3'

Sequencing Primer
(F):5'- ATGCTATAGATTTCTGACCCAGCG -3'
(R):5'- GAGCTGCATTAACCCTGTGAACTG -3'
Posted On2014-12-29