Incidental Mutation 'R2937:Olfr600'
ID255068
Institutional Source Beutler Lab
Gene Symbol Olfr600
Ensembl Gene ENSMUSG00000045540
Gene Nameolfactory receptor 600
SynonymsGA_x6K02T2PBJ9-6056235-6055291, MOR39-1
MMRRC Submission 040514-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R2937 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103343482-103349669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103346065 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 288 (M288V)
Ref Sequence ENSEMBL: ENSMUSP00000148967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056222] [ENSMUST00000215042]
Predicted Effect probably benign
Transcript: ENSMUST00000056222
AA Change: M288V

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000053887
Gene: ENSMUSG00000045540
AA Change: M288V

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.1e-97 PFAM
Pfam:7TM_GPCR_Srsx 37 226 1.2e-12 PFAM
Pfam:7tm_1 43 305 7.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215042
AA Change: M288V

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.1041 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 A G 7: 119,659,127 E481G probably damaging Het
Anks1b C T 10: 90,077,066 T351M probably damaging Het
Arhgap45 T A 10: 80,029,002 M933K probably damaging Het
Asph A C 4: 9,542,314 probably benign Het
Bace2 T C 16: 97,412,188 probably null Het
BC051142 A T 17: 34,421,862 H57L possibly damaging Het
Cacna1b A G 2: 24,606,528 V125A probably benign Het
Cbarp T C 10: 80,131,769 D539G probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdr1 T G X: 61,185,362 D66A unknown Het
Cela3b A G 4: 137,423,263 I208T probably benign Het
Clca3a2 T A 3: 144,813,918 T232S probably benign Het
Col1a2 G A 6: 4,519,882 probably benign Het
Col1a2 A T 6: 4,520,788 Q375L possibly damaging Het
Cpd T C 11: 76,811,859 N561S probably damaging Het
Csn1s1 A T 5: 87,677,136 Q221L possibly damaging Het
Depdc5 G A 5: 32,901,621 probably null Het
Dnah10 T C 5: 124,819,412 probably null Het
Dsg2 T C 18: 20,579,128 F107S probably damaging Het
Dthd1 A G 5: 62,842,957 I541V probably benign Het
Eml6 G A 11: 29,833,049 probably benign Het
Fermt2 A C 14: 45,504,491 probably null Het
Gimap8 A T 6: 48,658,796 R498S possibly damaging Het
Glis1 A G 4: 107,632,291 N692D possibly damaging Het
Grtp1 G A 8: 13,189,755 probably benign Het
Hecw1 G T 13: 14,245,836 Q1001K possibly damaging Het
Hydin T C 8: 110,404,295 V606A possibly damaging Het
Krt33b T A 11: 100,024,009 N388I probably benign Het
Lipf T C 19: 33,973,038 Y277H probably damaging Het
Lmod1 A G 1: 135,363,916 K170E probably benign Het
Lrrtm1 A T 6: 77,243,652 M31L probably benign Het
Maats1 A T 16: 38,311,038 I471N possibly damaging Het
Man1c1 A G 4: 134,702,952 I173T possibly damaging Het
Med17 T C 9: 15,275,891 K196E probably damaging Het
Mmp25 T A 17: 23,644,791 I22F probably benign Het
Nrg3 T A 14: 38,371,008 N540I possibly damaging Het
Nsun5 C T 5: 135,375,463 Q375* probably null Het
Olfr584 T A 7: 103,086,341 H269Q probably benign Het
Pcdh1 G T 18: 38,189,762 A1006E probably benign Het
Pdss1 T A 2: 22,906,787 probably null Het
Plaa G A 4: 94,569,459 A758V probably damaging Het
Prl6a1 T A 13: 27,315,320 W24R probably damaging Het
Ptk7 T C 17: 46,572,550 H863R probably damaging Het
Rbm10 T C X: 20,647,695 L429P possibly damaging Het
Rhou T C 8: 123,661,141 I204T possibly damaging Het
Serpind1 G T 16: 17,337,108 M266I probably benign Het
Sgcg A T 14: 61,229,625 F175L probably damaging Het
Slc2a2 T G 3: 28,718,771 C238G probably damaging Het
Slc39a8 A G 3: 135,886,823 M420V probably benign Het
Slc7a9 C A 7: 35,463,742 Y457* probably null Het
Smpd3 C T 8: 106,264,820 R367H probably damaging Het
Sntb2 T C 8: 106,936,097 V99A probably benign Het
Specc1l T G 10: 75,259,131 I796R probably damaging Het
Stfa2l1 G T 16: 36,159,946 V29F probably damaging Het
Synrg T C 11: 83,994,354 F455S probably damaging Het
Tap2 T C 17: 34,212,354 V422A possibly damaging Het
Tcf7 A T 11: 52,282,783 probably null Het
Tcp10a A G 17: 7,329,774 Y110C probably damaging Het
Thoc1 T A 18: 9,959,255 S43R probably damaging Het
Tlr1 A G 5: 64,925,908 V442A probably damaging Het
Tmub1 A G 5: 24,445,924 *261Q probably null Het
Trpc3 G A 3: 36,634,383 R836* probably null Het
Ube2u T C 4: 100,524,298 S185P possibly damaging Het
Vamp5 A G 6: 72,369,340 V91A probably benign Het
Vcp A G 4: 42,980,846 Y755H probably damaging Het
Vmn1r35 A T 6: 66,678,966 M73K possibly damaging Het
Vmn2r12 C T 5: 109,091,531 E389K probably damaging Het
Wdfy3 A T 5: 101,944,122 F450L probably benign Het
Xpo4 G T 14: 57,604,440 Q473K probably benign Het
Xpo7 A G 14: 70,671,690 I797T probably damaging Het
Xylt1 C A 7: 117,634,784 Q513K probably benign Het
Zfp229 T C 17: 21,745,503 F238S probably damaging Het
Other mutations in Olfr600
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Olfr600 APN 7 103346179 missense probably benign 0.15
IGL02239:Olfr600 APN 7 103346598 missense probably damaging 1.00
IGL02285:Olfr600 APN 7 103346038 nonsense probably null
IGL02547:Olfr600 APN 7 103346244 missense probably damaging 1.00
IGL03149:Olfr600 APN 7 103346849 missense probably benign 0.00
R0193:Olfr600 UTSW 7 103346204 missense possibly damaging 0.74
R0304:Olfr600 UTSW 7 103346711 missense probably damaging 1.00
R0454:Olfr600 UTSW 7 103346878 missense probably benign 0.02
R0622:Olfr600 UTSW 7 103346857 missense probably damaging 0.97
R1988:Olfr600 UTSW 7 103346109 missense possibly damaging 0.88
R1989:Olfr600 UTSW 7 103346109 missense possibly damaging 0.88
R4426:Olfr600 UTSW 7 103346083 missense probably damaging 1.00
R5362:Olfr600 UTSW 7 103346247 missense probably damaging 1.00
R5723:Olfr600 UTSW 7 103346619 missense possibly damaging 0.85
R6793:Olfr600 UTSW 7 103346266 missense probably benign 0.00
R6863:Olfr600 UTSW 7 103346916 missense possibly damaging 0.86
R6935:Olfr600 UTSW 7 103346795 missense probably damaging 1.00
R6983:Olfr600 UTSW 7 103346815 missense probably benign 0.00
R7262:Olfr600 UTSW 7 103346557 missense probably damaging 1.00
R7313:Olfr600 UTSW 7 103346331 missense probably benign 0.06
R7774:Olfr600 UTSW 7 103346530 missense possibly damaging 0.85
X0018:Olfr600 UTSW 7 103346899 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTTTCAAGAAAATCCTGAACTGG -3'
(R):5'- GGTCATCCTGTCGTATACACTG -3'

Sequencing Primer
(F):5'- TGGTAGAAATTATATGAACTTCTGGC -3'
(R):5'- GTATACACTGATTCTTCGTGCTG -3'
Posted On2014-12-29