Incidental Mutation 'R0318:Smg9'
ID25507
Institutional Source Beutler Lab
Gene Symbol Smg9
Ensembl Gene ENSMUSG00000002210
Gene Namesmg-9 homolog, nonsense mediated mRNA decay factor (C. elegans)
Synonyms1500002O20Rik, N28092
MMRRC Submission 038528-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0318 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location24399619-24422778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24420888 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 429 (F429S)
Ref Sequence ENSEMBL: ENSMUSP00000002280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002280]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002280
AA Change: F429S

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000002280
Gene: ENSMUSG00000002210
AA Change: F429S

DomainStartEndE-ValueType
low complexity region 79 93 N/A INTRINSIC
low complexity region 112 135 N/A INTRINSIC
Pfam:DUF2146 199 373 3.7e-8 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000123188
AA Change: F104S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148288
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.4%
  • 20x: 86.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulatory subunit of the SMG1 complex, which plays a critical role in nonsense-mediated mRNA decay (NMD). Binding of the encoded protein to the SMG1 complex kinase scaffold protein results in the inhibition of its kinase activity. Mutations in this gene cause a multiple congenital anomaly syndrome in human patients, characterized by brain malformation, congenital heart disease and other features. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a severe hypomorphic allele exhibit edema, hemorrhage, exencephaly, preaxial polydactyly, reduced size and growth, decreased mid- and hindrain size, microphthalmia, thin myocardium and atrioventricular septal defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,974 L79Q probably damaging Het
Add1 T C 5: 34,625,340 V130A probably damaging Het
Ankrd23 G T 1: 36,534,072 T73K probably benign Het
BC005561 T C 5: 104,517,753 F47S probably benign Het
Blk A G 14: 63,374,197 Y430H probably damaging Het
C3 C T 17: 57,224,709 V272M probably damaging Het
Cerk C T 15: 86,151,565 A254T possibly damaging Het
Ces2a G A 8: 104,740,824 A494T probably damaging Het
Cfap46 T C 7: 139,654,566 Y258C probably damaging Het
Chaf1a C T 17: 56,062,227 T486I possibly damaging Het
Colec12 A G 18: 9,848,446 N208S possibly damaging Het
Coro7 T A 16: 4,675,807 H63L probably benign Het
Cps1 T A 1: 67,177,014 W833R probably damaging Het
Csmd3 A T 15: 47,659,153 W2707R probably damaging Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Ddx50 A T 10: 62,642,837 I190K probably damaging Het
Dnmt3l G A 10: 78,055,055 V264M probably damaging Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Fam163a A G 1: 156,079,969 C26R probably damaging Het
Fam83h A G 15: 76,003,629 S620P probably benign Het
Fcna A G 2: 25,625,059 S263P probably benign Het
Fnip2 A T 3: 79,512,378 S165R probably damaging Het
Fpr-rs3 T C 17: 20,624,148 T244A probably benign Het
Gpr152 T C 19: 4,143,542 S361P possibly damaging Het
Grm5 A T 7: 87,602,967 I142L probably damaging Het
Gucy2g A G 19: 55,237,798 S229P probably benign Het
Htr7 C T 19: 35,969,486 G376D probably damaging Het
Irgc1 T C 7: 24,432,471 D307G probably benign Het
Irs1 A T 1: 82,288,660 S612T probably benign Het
Maml2 C T 9: 13,620,594 T368I probably damaging Het
Mapkapk2 A G 1: 131,097,335 V64A probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Nptx1 C T 11: 119,542,541 E411K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr995 C A 2: 85,438,237 R307M possibly damaging Het
Pcgf5 A T 19: 36,412,190 K22N possibly damaging Het
Psmd9 C A 5: 123,234,649 A65E possibly damaging Het
Sh3bp1 A G 15: 78,911,707 T679A probably damaging Het
Sipa1l2 G A 8: 125,447,697 P1281S possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc25a24 A G 3: 109,157,000 M222V probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Sorl1 T A 9: 42,081,954 Y258F probably damaging Het
Srp72 C T 5: 76,984,200 T242I probably benign Het
Stc1 A T 14: 69,038,418 Q220L probably damaging Het
Tas2r122 T C 6: 132,711,832 T33A possibly damaging Het
Tbc1d10b A G 7: 127,199,034 L645P probably damaging Het
Timd4 T A 11: 46,837,071 H272Q probably benign Het
Ttll5 T G 12: 85,876,594 probably null Het
Veph1 G T 3: 66,057,259 S783Y probably damaging Het
Vmn1r230 T C 17: 20,846,816 L89S possibly damaging Het
Xcr1 A G 9: 123,856,154 V165A possibly damaging Het
Zfp286 T C 11: 62,784,962 D58G probably damaging Het
Zfyve26 C T 12: 79,276,281 R897H probably damaging Het
Other mutations in Smg9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Smg9 APN 7 24416951 missense probably damaging 1.00
IGL01432:Smg9 APN 7 24421266 critical splice donor site probably null
IGL01869:Smg9 APN 7 24416524 missense probably damaging 1.00
IGL02376:Smg9 APN 7 24415030 missense probably benign 0.01
IGL03175:Smg9 APN 7 24422305 missense probably damaging 1.00
IGL03204:Smg9 APN 7 24420912 missense probably benign 0.02
R0578:Smg9 UTSW 7 24415043 missense probably damaging 1.00
R0786:Smg9 UTSW 7 24420864 missense probably benign 0.03
R2043:Smg9 UTSW 7 24405576 missense possibly damaging 0.92
R2355:Smg9 UTSW 7 24420121 critical splice donor site probably null
R3033:Smg9 UTSW 7 24416524 missense probably damaging 1.00
R4091:Smg9 UTSW 7 24420867 missense probably null 0.01
R4773:Smg9 UTSW 7 24407594 missense possibly damaging 0.84
R5023:Smg9 UTSW 7 24405872 missense possibly damaging 0.94
R5517:Smg9 UTSW 7 24414913 unclassified probably benign
R6320:Smg9 UTSW 7 24420861 missense probably benign
R6394:Smg9 UTSW 7 24422307 missense probably damaging 1.00
R7156:Smg9 UTSW 7 24420861 missense probably benign
R7269:Smg9 UTSW 7 24406070 missense possibly damaging 0.88
R7311:Smg9 UTSW 7 24420633 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGATTGACCAGCTCATGGCACAC -3'
(R):5'- TGCTTCAGACCAGCTTTTCCCAAAC -3'

Sequencing Primer
(F):5'- ATAGATTGTATGCCACTCCCAGG -3'
(R):5'- AGCTTTTCCCAAACCTCTCCAG -3'
Posted On2013-04-16