Mutagenetix > Incidental Mutation

Incidental Mutation 'R2937:Cdh15'

255075

Institutional Source

Beutler Lab

Gene Symbol

Cdh15

Ensembl Gene

ENSMUSG00000031962

Gene Name

cadherin 15

Synonyms

M cadherin, Mcad, Cdh14

MMRRC Submission

040514-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2937 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

122847966-122867397 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 122862024 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 279 (R279Q)

Ref Sequence

ENSEMBL: ENSMUSP00000034443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]

AlphaFold

P33146

Predicted Effect

probably damaging
Transcript: ENSMUST00000034443
AA Change: R279Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962
AA Change: R279Q

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CA	64	149	5.95e-18	SMART
CA	173	257	3.09e-25	SMART
CA	280	373	2.5e-11	SMART
CA	396	480	3.45e-14	SMART
Pfam:Cadherin	486	579	5.2e-9	PFAM
transmembrane domain	603	625	N/A	INTRINSIC
Pfam:Cadherin_C	633	783	6.7e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (73/73)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm1	A	G	7: 119,659,127	E481G	probably damaging	Het
Anks1b	C	T	10: 90,077,066	T351M	probably damaging	Het
Arhgap45	T	A	10: 80,029,002	M933K	probably damaging	Het
Asph	A	C	4: 9,542,314		probably benign	Het
Bace2	T	C	16: 97,412,188		probably null	Het
BC051142	A	T	17: 34,421,862	H57L	possibly damaging	Het
Cacna1b	A	G	2: 24,606,528	V125A	probably benign	Het
Cbarp	T	C	10: 80,131,769	D539G	probably damaging	Het
Ccdc59	A	T	10: 105,841,527	K9M	possibly damaging	Het
Cdr1	T	G	X: 61,185,362	D66A	unknown	Het
Cela3b	A	G	4: 137,423,263	I208T	probably benign	Het
Clca3a2	T	A	3: 144,813,918	T232S	probably benign	Het
Col1a2	G	A	6: 4,519,882		probably benign	Het
Col1a2	A	T	6: 4,520,788	Q375L	possibly damaging	Het
Cpd	T	C	11: 76,811,859	N561S	probably damaging	Het
Csn1s1	A	T	5: 87,677,136	Q221L	possibly damaging	Het
Depdc5	G	A	5: 32,901,621		probably null	Het
Dnah10	T	C	5: 124,819,412		probably null	Het
Dsg2	T	C	18: 20,579,128	F107S	probably damaging	Het
Dthd1	A	G	5: 62,842,957	I541V	probably benign	Het
Eml6	G	A	11: 29,833,049		probably benign	Het
Fermt2	A	C	14: 45,504,491		probably null	Het
Gimap8	A	T	6: 48,658,796	R498S	possibly damaging	Het
Glis1	A	G	4: 107,632,291	N692D	possibly damaging	Het
Grtp1	G	A	8: 13,189,755		probably benign	Het
Hecw1	G	T	13: 14,245,836	Q1001K	possibly damaging	Het
Hydin	T	C	8: 110,404,295	V606A	possibly damaging	Het
Krt33b	T	A	11: 100,024,009	N388I	probably benign	Het
Lipf	T	C	19: 33,973,038	Y277H	probably damaging	Het
Lmod1	A	G	1: 135,363,916	K170E	probably benign	Het
Lrrtm1	A	T	6: 77,243,652	M31L	probably benign	Het
Maats1	A	T	16: 38,311,038	I471N	possibly damaging	Het
Man1c1	A	G	4: 134,702,952	I173T	possibly damaging	Het
Med17	T	C	9: 15,275,891	K196E	probably damaging	Het
Mmp25	T	A	17: 23,644,791	I22F	probably benign	Het
Nrg3	T	A	14: 38,371,008	N540I	possibly damaging	Het
Nsun5	C	T	5: 135,375,463	Q375*	probably null	Het
Olfr584	T	A	7: 103,086,341	H269Q	probably benign	Het
Olfr600	T	C	7: 103,346,065	M288V	probably benign	Het
Pcdh1	G	T	18: 38,189,762	A1006E	probably benign	Het
Pdss1	T	A	2: 22,906,787		probably null	Het
Plaa	G	A	4: 94,569,459	A758V	probably damaging	Het
Prl6a1	T	A	13: 27,315,320	W24R	probably damaging	Het
Ptk7	T	C	17: 46,572,550	H863R	probably damaging	Het
Rbm10	T	C	X: 20,647,695	L429P	possibly damaging	Het
Rhou	T	C	8: 123,661,141	I204T	possibly damaging	Het
Serpind1	G	T	16: 17,337,108	M266I	probably benign	Het
Sgcg	A	T	14: 61,229,625	F175L	probably damaging	Het
Slc2a2	T	G	3: 28,718,771	C238G	probably damaging	Het
Slc39a8	A	G	3: 135,886,823	M420V	probably benign	Het
Slc7a9	C	A	7: 35,463,742	Y457*	probably null	Het
Smpd3	C	T	8: 106,264,820	R367H	probably damaging	Het
Sntb2	T	C	8: 106,936,097	V99A	probably benign	Het
Specc1l	T	G	10: 75,259,131	I796R	probably damaging	Het
Stfa2l1	G	T	16: 36,159,946	V29F	probably damaging	Het
Synrg	T	C	11: 83,994,354	F455S	probably damaging	Het
Tap2	T	C	17: 34,212,354	V422A	possibly damaging	Het
Tcf7	A	T	11: 52,282,783		probably null	Het
Tcp10a	A	G	17: 7,329,774	Y110C	probably damaging	Het
Thoc1	T	A	18: 9,959,255	S43R	probably damaging	Het
Tlr1	A	G	5: 64,925,908	V442A	probably damaging	Het
Tmub1	A	G	5: 24,445,924	*261Q	probably null	Het
Trpc3	G	A	3: 36,634,383	R836*	probably null	Het
Ube2u	T	C	4: 100,524,298	S185P	possibly damaging	Het
Vamp5	A	G	6: 72,369,340	V91A	probably benign	Het
Vcp	A	G	4: 42,980,846	Y755H	probably damaging	Het
Vmn1r35	A	T	6: 66,678,966	M73K	possibly damaging	Het
Vmn2r12	C	T	5: 109,091,531	E389K	probably damaging	Het
Wdfy3	A	T	5: 101,944,122	F450L	probably benign	Het
Xpo4	G	T	14: 57,604,440	Q473K	probably benign	Het
Xpo7	A	G	14: 70,671,690	I797T	probably damaging	Het
Xylt1	C	A	7: 117,634,784	Q513K	probably benign	Het
Zfp229	T	C	17: 21,745,503	F238S	probably damaging	Het

Other mutations in Cdh15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cdh15	APN	8	122865323	intron	probably benign
IGL01958:Cdh15	APN	8	122859350	missense	probably damaging	1.00
IGL02588:Cdh15	APN	8	122856552	nonsense	probably null
IGL02793:Cdh15	APN	8	122860982	missense	probably damaging	1.00
IGL02947:Cdh15	APN	8	122865372	missense	probably benign	0.00
R0310:Cdh15	UTSW	8	122865436	missense	probably damaging	1.00
R0441:Cdh15	UTSW	8	122860966	missense	probably damaging	1.00
R0766:Cdh15	UTSW	8	122861449	intron	probably benign
R0898:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1023:Cdh15	UTSW	8	122865200	missense	probably damaging	0.98
R1054:Cdh15	UTSW	8	122864337	missense	possibly damaging	0.85
R1072:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R1081:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1101:Cdh15	UTSW	8	122860846	missense	possibly damaging	0.93
R1208:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1208:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1209:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1210:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1312:Cdh15	UTSW	8	122861449	intron	probably benign
R1317:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1318:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1393:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1428:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1429:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1695:Cdh15	UTSW	8	122862016	missense	probably benign	0.05
R2157:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2170:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2178:Cdh15	UTSW	8	122864976	splice site	probably null
R2252:Cdh15	UTSW	8	122857422	missense	probably damaging	1.00
R2290:Cdh15	UTSW	8	122859317	missense	probably damaging	1.00
R2317:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2330:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2345:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2349:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2353:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2354:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2566:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2567:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2568:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2893:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2894:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2938:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2990:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2992:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2993:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3029:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3030:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3195:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R3441:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3442:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3608:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3686:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R4119:Cdh15	UTSW	8	122863423	missense	probably damaging	1.00
R4120:Cdh15	UTSW	8	122863423	missense	probably damaging	1.00
R4477:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4478:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4480:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4580:Cdh15	UTSW	8	122865158	missense	probably damaging	0.99
R4583:Cdh15	UTSW	8	122865028	missense	probably damaging	0.98
R4619:Cdh15	UTSW	8	122860873	missense	probably damaging	1.00
R4694:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R4731:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R5076:Cdh15	UTSW	8	122864348	missense	possibly damaging	0.82
R5347:Cdh15	UTSW	8	122862063	missense	probably null	1.00
R5375:Cdh15	UTSW	8	122865100	missense	probably damaging	1.00
R5498:Cdh15	UTSW	8	122865178	missense	possibly damaging	0.79
R5778:Cdh15	UTSW	8	122856587	missense	possibly damaging	0.80
R6320:Cdh15	UTSW	8	122864347	missense	probably benign	0.01
R6570:Cdh15	UTSW	8	122857391	missense	probably damaging	1.00
R6708:Cdh15	UTSW	8	122863555	missense	probably benign	0.32
R7505:Cdh15	UTSW	8	122848492	missense	probably benign	0.01
R7527:Cdh15	UTSW	8	122862126	missense	probably damaging	1.00
R7724:Cdh15	UTSW	8	122866961	missense	probably damaging	1.00
R8093:Cdh15	UTSW	8	122866835	missense	probably damaging	1.00
R8485:Cdh15	UTSW	8	122857366	missense	probably damaging	1.00
R8759:Cdh15	UTSW	8	122860889	missense	probably damaging	1.00
R8910:Cdh15	UTSW	8	122848501	missense	probably benign	0.04
R9017:Cdh15	UTSW	8	122857517	critical splice donor site	probably null
R9453:Cdh15	UTSW	8	122859290	missense	probably damaging	0.99
R9699:Cdh15	UTSW	8	122862030	missense	probably benign	0.00
R9705:Cdh15	UTSW	8	122864285	missense	probably damaging	1.00
Z1176:Cdh15	UTSW	8	122864259	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGTCCAATATCCAGGAGCAG -3'
(R):5'- GGATTCTAGCTGAGGGAACAC -3'

Sequencing Primer
(F):5'- TGGGATCCATGGCTCTGGAAAC -3'
(R):5'- TTCTAGCTGAGGGAACACACATGAC -3'

Posted On

2014-12-29