Incidental Mutation 'R2937:Ptk7'
ID255104
Institutional Source Beutler Lab
Gene Symbol Ptk7
Ensembl Gene ENSMUSG00000023972
Gene NamePTK7 protein tyrosine kinase 7
Synonyms8430404F20Rik, mPTK7/CCK4, chz
MMRRC Submission 040514-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2937 (G1)
Quality Score147
Status Validated
Chromosome17
Chromosomal Location46564451-46629504 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46572550 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 863 (H863R)
Ref Sequence ENSEMBL: ENSMUSP00000043703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044442]
Predicted Effect probably damaging
Transcript: ENSMUST00000044442
AA Change: H863R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043703
Gene: ENSMUSG00000023972
AA Change: H863R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGc2 36 100 1.48e-6 SMART
IGc2 133 199 8.12e-13 SMART
IGc2 229 300 5.01e-4 SMART
IGc2 326 390 1.96e-6 SMART
IG 410 491 6.02e-7 SMART
IGc2 507 569 1.19e-10 SMART
IGc2 596 663 2.6e-11 SMART
transmembrane domain 696 718 N/A INTRINSIC
TyrKc 788 1053 4.34e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Meta Mutation Damage Score 0.5751 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine kinase family of proteins that transduce extracellular signals across the cell membrane. The encoded protein lacks detectable catalytic tyrosine kinase activity, is involved in the Wnt signaling pathway and plays a role in multiple cellular processes including polarity and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele die perinatally with defects in neural tube closure and planar cell polarity in the ear. ENU-induced mutant mice show omphalocele, impaired neural tube, heart and lung development, rib defects, polydactyly, failed eyelid closure and altered cell polarity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 A G 7: 119,659,127 E481G probably damaging Het
Anks1b C T 10: 90,077,066 T351M probably damaging Het
Arhgap45 T A 10: 80,029,002 M933K probably damaging Het
Asph A C 4: 9,542,314 probably benign Het
Bace2 T C 16: 97,412,188 probably null Het
BC051142 A T 17: 34,421,862 H57L possibly damaging Het
Cacna1b A G 2: 24,606,528 V125A probably benign Het
Cbarp T C 10: 80,131,769 D539G probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdr1 T G X: 61,185,362 D66A unknown Het
Cela3b A G 4: 137,423,263 I208T probably benign Het
Clca3a2 T A 3: 144,813,918 T232S probably benign Het
Col1a2 G A 6: 4,519,882 probably benign Het
Col1a2 A T 6: 4,520,788 Q375L possibly damaging Het
Cpd T C 11: 76,811,859 N561S probably damaging Het
Csn1s1 A T 5: 87,677,136 Q221L possibly damaging Het
Depdc5 G A 5: 32,901,621 probably null Het
Dnah10 T C 5: 124,819,412 probably null Het
Dsg2 T C 18: 20,579,128 F107S probably damaging Het
Dthd1 A G 5: 62,842,957 I541V probably benign Het
Eml6 G A 11: 29,833,049 probably benign Het
Fermt2 A C 14: 45,504,491 probably null Het
Gimap8 A T 6: 48,658,796 R498S possibly damaging Het
Glis1 A G 4: 107,632,291 N692D possibly damaging Het
Grtp1 G A 8: 13,189,755 probably benign Het
Hecw1 G T 13: 14,245,836 Q1001K possibly damaging Het
Hydin T C 8: 110,404,295 V606A possibly damaging Het
Krt33b T A 11: 100,024,009 N388I probably benign Het
Lipf T C 19: 33,973,038 Y277H probably damaging Het
Lmod1 A G 1: 135,363,916 K170E probably benign Het
Lrrtm1 A T 6: 77,243,652 M31L probably benign Het
Maats1 A T 16: 38,311,038 I471N possibly damaging Het
Man1c1 A G 4: 134,702,952 I173T possibly damaging Het
Med17 T C 9: 15,275,891 K196E probably damaging Het
Mmp25 T A 17: 23,644,791 I22F probably benign Het
Nrg3 T A 14: 38,371,008 N540I possibly damaging Het
Nsun5 C T 5: 135,375,463 Q375* probably null Het
Olfr584 T A 7: 103,086,341 H269Q probably benign Het
Olfr600 T C 7: 103,346,065 M288V probably benign Het
Pcdh1 G T 18: 38,189,762 A1006E probably benign Het
Pdss1 T A 2: 22,906,787 probably null Het
Plaa G A 4: 94,569,459 A758V probably damaging Het
Prl6a1 T A 13: 27,315,320 W24R probably damaging Het
Rbm10 T C X: 20,647,695 L429P possibly damaging Het
Rhou T C 8: 123,661,141 I204T possibly damaging Het
Serpind1 G T 16: 17,337,108 M266I probably benign Het
Sgcg A T 14: 61,229,625 F175L probably damaging Het
Slc2a2 T G 3: 28,718,771 C238G probably damaging Het
Slc39a8 A G 3: 135,886,823 M420V probably benign Het
Slc7a9 C A 7: 35,463,742 Y457* probably null Het
Smpd3 C T 8: 106,264,820 R367H probably damaging Het
Sntb2 T C 8: 106,936,097 V99A probably benign Het
Specc1l T G 10: 75,259,131 I796R probably damaging Het
Stfa2l1 G T 16: 36,159,946 V29F probably damaging Het
Synrg T C 11: 83,994,354 F455S probably damaging Het
Tap2 T C 17: 34,212,354 V422A possibly damaging Het
Tcf7 A T 11: 52,282,783 probably null Het
Tcp10a A G 17: 7,329,774 Y110C probably damaging Het
Thoc1 T A 18: 9,959,255 S43R probably damaging Het
Tlr1 A G 5: 64,925,908 V442A probably damaging Het
Tmub1 A G 5: 24,445,924 *261Q probably null Het
Trpc3 G A 3: 36,634,383 R836* probably null Het
Ube2u T C 4: 100,524,298 S185P possibly damaging Het
Vamp5 A G 6: 72,369,340 V91A probably benign Het
Vcp A G 4: 42,980,846 Y755H probably damaging Het
Vmn1r35 A T 6: 66,678,966 M73K possibly damaging Het
Vmn2r12 C T 5: 109,091,531 E389K probably damaging Het
Wdfy3 A T 5: 101,944,122 F450L probably benign Het
Xpo4 G T 14: 57,604,440 Q473K probably benign Het
Xpo7 A G 14: 70,671,690 I797T probably damaging Het
Xylt1 C A 7: 117,634,784 Q513K probably benign Het
Zfp229 T C 17: 21,745,503 F238S probably damaging Het
Other mutations in Ptk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Ptk7 APN 17 46574427 missense probably damaging 1.00
IGL01064:Ptk7 APN 17 46573566 nonsense probably null
IGL01444:Ptk7 APN 17 46565387 missense probably damaging 1.00
IGL01477:Ptk7 APN 17 46576880 missense possibly damaging 0.61
IGL01727:Ptk7 APN 17 46572548 missense probably damaging 1.00
IGL01958:Ptk7 APN 17 46579427 missense probably benign 0.37
IGL02496:Ptk7 APN 17 46590144 missense probably benign 0.04
IGL02864:Ptk7 APN 17 46572733 missense probably damaging 1.00
R0008:Ptk7 UTSW 17 46572762 splice site probably benign
R0671:Ptk7 UTSW 17 46590312 missense possibly damaging 0.94
R1464:Ptk7 UTSW 17 46572591 missense probably damaging 1.00
R1464:Ptk7 UTSW 17 46572591 missense probably damaging 1.00
R1549:Ptk7 UTSW 17 46572652 missense probably damaging 1.00
R1635:Ptk7 UTSW 17 46573534 missense possibly damaging 0.81
R1646:Ptk7 UTSW 17 46586297 missense probably benign 0.44
R1846:Ptk7 UTSW 17 46576490 critical splice donor site probably null
R1973:Ptk7 UTSW 17 46586807 nonsense probably null
R2060:Ptk7 UTSW 17 46566238 missense possibly damaging 0.83
R2155:Ptk7 UTSW 17 46579617 missense probably benign 0.09
R2472:Ptk7 UTSW 17 46576848 missense probably benign 0.35
R3824:Ptk7 UTSW 17 46565378 missense probably damaging 1.00
R3845:Ptk7 UTSW 17 46586418 missense probably benign 0.00
R4222:Ptk7 UTSW 17 46574463 missense probably benign
R4671:Ptk7 UTSW 17 46574466 missense probably benign
R4922:Ptk7 UTSW 17 46576491 critical splice donor site probably null
R5319:Ptk7 UTSW 17 46572677 missense probably damaging 1.00
R5993:Ptk7 UTSW 17 46565370 missense probably benign
R6254:Ptk7 UTSW 17 46572642 missense probably damaging 1.00
R6352:Ptk7 UTSW 17 46576890 missense probably benign 0.00
R6806:Ptk7 UTSW 17 46573528 missense probably damaging 0.99
R7338:Ptk7 UTSW 17 46579599 missense probably benign 0.00
R7394:Ptk7 UTSW 17 46591757 missense probably damaging 1.00
R7709:Ptk7 UTSW 17 46571643 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ATTGACCTCCAGAAAGACGGG -3'
(R):5'- CACCAGGGAAAAGCGAGTTC -3'

Sequencing Primer
(F):5'- GAATACAGGTAAAGGCAGGGCTG -3'
(R):5'- AGGTGTTCCTGGCAAAGGC -3'
Posted On2014-12-29