Incidental Mutation 'R2940:Rnf25'
ID255111
Institutional Source Beutler Lab
Gene Symbol Rnf25
Ensembl Gene ENSMUSG00000026171
Gene Namering finger protein 25
Synonyms0610009H16Rik, AO7
MMRRC Submission 040517-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2940 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location74593748-74601397 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74595888 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 135 (V135A)
Ref Sequence ENSEMBL: ENSMUSP00000109350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027357] [ENSMUST00000027358] [ENSMUST00000113721] [ENSMUST00000113732] [ENSMUST00000113733] [ENSMUST00000127938] [ENSMUST00000132081] [ENSMUST00000135140] [ENSMUST00000154874]
Predicted Effect probably benign
Transcript: ENSMUST00000027357
AA Change: V135A

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027357
Gene: ENSMUSG00000026171
AA Change: V135A

DomainStartEndE-ValueType
RWD 18 127 4.66e-31 SMART
RING 134 198 2.87e-5 SMART
low complexity region 368 378 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000027358
SMART Domains Protein: ENSMUSP00000027358
Gene: ENSMUSG00000026172

DomainStartEndE-ValueType
BCS1_N 23 191 1.29e-86 SMART
AAA 222 357 3.23e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113721
AA Change: V135A

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109350
Gene: ENSMUSG00000026171
AA Change: V135A

DomainStartEndE-ValueType
RWD 18 127 4.66e-31 SMART
RING 134 197 3.53e-5 SMART
low complexity region 367 377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113732
SMART Domains Protein: ENSMUSP00000109361
Gene: ENSMUSG00000026172

DomainStartEndE-ValueType
BCS1_N 23 191 1.29e-86 SMART
AAA 222 357 3.23e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113733
SMART Domains Protein: ENSMUSP00000109362
Gene: ENSMUSG00000026172

DomainStartEndE-ValueType
BCS1_N 23 191 1.29e-86 SMART
AAA 222 357 3.23e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127938
AA Change: V24A

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000116973
Gene: ENSMUSG00000026171
AA Change: V24A

DomainStartEndE-ValueType
RING 23 87 2.87e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128491
Predicted Effect probably benign
Transcript: ENSMUST00000132081
Predicted Effect probably benign
Transcript: ENSMUST00000135140
Predicted Effect probably benign
Transcript: ENSMUST00000136078
SMART Domains Protein: ENSMUSP00000117692
Gene: ENSMUSG00000026171

DomainStartEndE-ValueType
RWD 24 123 1.97e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149649
Predicted Effect probably benign
Transcript: ENSMUST00000154874
AA Change: V102A

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120646
Gene: ENSMUSG00000026171
AA Change: V102A

DomainStartEndE-ValueType
RWD 1 94 6.36e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151003
Meta Mutation Damage Score 0.0618 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger motif. The mouse counterpart of this protein has been shown to interact with Rela, the p65 subunit of NF-kappaB (NFKB), and modulate NFKB-mediated transcription activity. The mouse protein also binds ubiquitin-conjugating enzymes (E2s) and is a substrate for E2-dependent ubiquitination. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,805 D1878G probably damaging Het
Adcy2 A G 13: 68,730,305 W405R probably damaging Het
Apc G A 18: 34,276,670 R221H probably damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Cngb1 T C 8: 95,252,107 I573V probably benign Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dmap1 G A 4: 117,676,005 T284M possibly damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif3a T C 19: 60,773,677 T487A probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam180a A T 6: 35,313,629 S140T possibly damaging Het
Fibcd1 T C 2: 31,817,264 Y327C probably damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Igfbp1 A G 11: 7,201,970 T258A probably benign Het
Isl1 T C 13: 116,308,299 T65A possibly damaging Het
Khdrbs3 T A 15: 69,049,390 D185E probably damaging Het
Klc1 C T 12: 111,806,017 R157C possibly damaging Het
Lamc3 A G 2: 31,940,702 S1484G probably benign Het
Lman1 G T 18: 65,984,273 P466Q possibly damaging Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbea C G 3: 55,934,624 E1879Q probably benign Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pigc T C 1: 161,970,670 Y74H possibly damaging Het
Plek C T 11: 16,992,887 probably null Het
Rasgrf1 C T 9: 89,991,714 A692V possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Sh3rf2 G A 18: 42,111,440 probably null Het
Sh3tc2 A G 18: 61,989,686 D506G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Sorbs1 T C 19: 40,373,571 D123G probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Tubb6 A G 18: 67,401,924 N298D probably damaging Het
Xpo7 A T 14: 70,667,136 L1020Q probably damaging Het
Xpo7 G T 14: 70,667,137 L1020I probably benign Het
Zswim4 A T 8: 84,223,748 L611Q probably damaging Het
Other mutations in Rnf25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02542:Rnf25 APN 1 74594101 missense probably benign 0.02
IGL03268:Rnf25 APN 1 74599058 unclassified probably benign
R1570:Rnf25 UTSW 1 74595267 missense probably damaging 1.00
R1740:Rnf25 UTSW 1 74598727 missense probably damaging 1.00
R2086:Rnf25 UTSW 1 74593967 missense probably damaging 0.99
R2939:Rnf25 UTSW 1 74595888 missense possibly damaging 0.50
R4556:Rnf25 UTSW 1 74599105 missense probably damaging 1.00
R4770:Rnf25 UTSW 1 74593940 missense probably damaging 1.00
R5075:Rnf25 UTSW 1 74595644 missense probably benign
R5394:Rnf25 UTSW 1 74595252 missense probably damaging 1.00
R6319:Rnf25 UTSW 1 74595731 missense probably damaging 1.00
R6960:Rnf25 UTSW 1 74595244 missense possibly damaging 0.66
R8039:Rnf25 UTSW 1 74593964 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCTGGATGTACCTGGCAAG -3'
(R):5'- CTTAGATATTGAAACCAGGAAGGCC -3'

Sequencing Primer
(F):5'- CCTGGCAAGGCAATGGC -3'
(R):5'- TATTGAAACCAGGAAGGCCAAATG -3'
Posted On2014-12-29