Incidental Mutation 'R2940:Dmap1'
ID255120
Institutional Source Beutler Lab
Gene Symbol Dmap1
Ensembl Gene ENSMUSG00000009640
Gene NameDNA methyltransferase 1-associated protein 1
Synonyms1500016M21Rik
MMRRC Submission 040517-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2940 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location117674681-117682273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 117676005 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 284 (T284M)
Ref Sequence ENSEMBL: ENSMUSP00000099748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037127] [ENSMUST00000102687]
Predicted Effect probably benign
Transcript: ENSMUST00000037127
SMART Domains Protein: ENSMUSP00000042796
Gene: ENSMUSG00000033423

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
EXOIII 145 329 1.17e-42 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102687
AA Change: T284M

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099748
Gene: ENSMUSG00000009640
AA Change: T284M

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
SANT 148 201 3.38e-2 SMART
Pfam:DMAP1 243 404 7.1e-76 PFAM
low complexity region 449 467 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146384
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of several, distinct complexes involved in the repression or activation of transcription. The encoded protein can independently repress transcription and is targeted to replication foci throughout S phase by interacting directly with the N-terminus of DNA methyltransferase 1. During late S phase, histone deacetylase 2 is added to this complex, providing a means to deacetylate histones in transcriptionally inactive heterochromatin following replication. The encoded protein is also a component of the nucleosome acetyltransferase of H4 complex and interacts with the transcriptional corepressor tumor susceptibility gene 101 and the pro-apoptotic death-associated protein 6, among others. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die prior to implantation with no 8-cell embryos detected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,805 D1878G probably damaging Het
Adcy2 A G 13: 68,730,305 W405R probably damaging Het
Apc G A 18: 34,276,670 R221H probably damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Cngb1 T C 8: 95,252,107 I573V probably benign Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif3a T C 19: 60,773,677 T487A probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam180a A T 6: 35,313,629 S140T possibly damaging Het
Fibcd1 T C 2: 31,817,264 Y327C probably damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Igfbp1 A G 11: 7,201,970 T258A probably benign Het
Isl1 T C 13: 116,308,299 T65A possibly damaging Het
Khdrbs3 T A 15: 69,049,390 D185E probably damaging Het
Klc1 C T 12: 111,806,017 R157C possibly damaging Het
Lamc3 A G 2: 31,940,702 S1484G probably benign Het
Lman1 G T 18: 65,984,273 P466Q possibly damaging Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbea C G 3: 55,934,624 E1879Q probably benign Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pigc T C 1: 161,970,670 Y74H possibly damaging Het
Plek C T 11: 16,992,887 probably null Het
Rasgrf1 C T 9: 89,991,714 A692V possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Sh3rf2 G A 18: 42,111,440 probably null Het
Sh3tc2 A G 18: 61,989,686 D506G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Sorbs1 T C 19: 40,373,571 D123G probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Tubb6 A G 18: 67,401,924 N298D probably damaging Het
Xpo7 A T 14: 70,667,136 L1020Q probably damaging Het
Xpo7 G T 14: 70,667,137 L1020I probably benign Het
Zswim4 A T 8: 84,223,748 L611Q probably damaging Het
Other mutations in Dmap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Dmap1 APN 4 117676396 missense possibly damaging 0.67
IGL01517:Dmap1 APN 4 117676009 missense probably damaging 1.00
IGL02926:Dmap1 APN 4 117681888 missense probably benign 0.01
R0118:Dmap1 UTSW 4 117676483 missense probably damaging 1.00
R1586:Dmap1 UTSW 4 117676122 missense probably damaging 0.98
R2504:Dmap1 UTSW 4 117675298 missense probably damaging 1.00
R4168:Dmap1 UTSW 4 117681310 missense possibly damaging 0.91
R4723:Dmap1 UTSW 4 117676039 missense probably benign 0.05
R4975:Dmap1 UTSW 4 117681036 missense possibly damaging 0.91
R5797:Dmap1 UTSW 4 117675480 missense possibly damaging 0.94
R5905:Dmap1 UTSW 4 117676766 missense probably benign 0.00
R5987:Dmap1 UTSW 4 117680842 critical splice donor site probably null
R6117:Dmap1 UTSW 4 117675535 intron probably null
Predicted Primers PCR Primer
(F):5'- TAAGGAGCCTTAGGTGTCACG -3'
(R):5'- TAACCTAGTGTCCCGTCAGC -3'

Sequencing Primer
(F):5'- CCTTAGGTGTCACGGGGAG -3'
(R):5'- GCCACTTGCTTCCACACAG -3'
Posted On2014-12-29