Incidental Mutation 'R2940:Crybg2'
ID255122
Institutional Source Beutler Lab
Gene Symbol Crybg2
Ensembl Gene ENSMUSG00000012123
Gene Namecrystallin beta-gamma domain containing 2
SynonymsAim1l
MMRRC Submission 040517-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.857) question?
Stock #R2940 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location134060815-134092504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134082434 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1517 (H1517R)
Ref Sequence ENSEMBL: ENSMUSP00000154159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121391] [ENSMUST00000149956] [ENSMUST00000227683]
Predicted Effect probably benign
Transcript: ENSMUST00000121391
AA Change: H1208R

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114099
Gene: ENSMUSG00000012123
AA Change: H1208R

DomainStartEndE-ValueType
low complexity region 171 205 N/A INTRINSIC
low complexity region 210 226 N/A INTRINSIC
low complexity region 414 443 N/A INTRINSIC
low complexity region 560 582 N/A INTRINSIC
low complexity region 608 625 N/A INTRINSIC
coiled coil region 683 703 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
XTALbg 842 921 2.56e-7 SMART
XTALbg 929 1010 9.33e-10 SMART
XTALbg 1024 1110 5.06e-29 SMART
XTALbg 1118 1199 1.4e-22 SMART
XTALbg 1212 1291 2.22e-16 SMART
XTALbg 1299 1379 1.69e-16 SMART
RICIN 1383 1514 7.89e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149504
Predicted Effect probably benign
Transcript: ENSMUST00000149956
AA Change: H246R

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123349
Gene: ENSMUSG00000012123
AA Change: H246R

DomainStartEndE-ValueType
XTALbg 1 60 1.39e-2 SMART
XTALbg 62 148 3.99e-27 SMART
XTALbg 156 237 1.4e-22 SMART
XTALbg 250 293 7.78e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153392
Predicted Effect possibly damaging
Transcript: ENSMUST00000227683
AA Change: H1517R

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.0819 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,805 D1878G probably damaging Het
Adcy2 A G 13: 68,730,305 W405R probably damaging Het
Apc G A 18: 34,276,670 R221H probably damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Cngb1 T C 8: 95,252,107 I573V probably benign Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dmap1 G A 4: 117,676,005 T284M possibly damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif3a T C 19: 60,773,677 T487A probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam180a A T 6: 35,313,629 S140T possibly damaging Het
Fibcd1 T C 2: 31,817,264 Y327C probably damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Igfbp1 A G 11: 7,201,970 T258A probably benign Het
Isl1 T C 13: 116,308,299 T65A possibly damaging Het
Khdrbs3 T A 15: 69,049,390 D185E probably damaging Het
Klc1 C T 12: 111,806,017 R157C possibly damaging Het
Lamc3 A G 2: 31,940,702 S1484G probably benign Het
Lman1 G T 18: 65,984,273 P466Q possibly damaging Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbea C G 3: 55,934,624 E1879Q probably benign Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pigc T C 1: 161,970,670 Y74H possibly damaging Het
Plek C T 11: 16,992,887 probably null Het
Rasgrf1 C T 9: 89,991,714 A692V possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Sh3rf2 G A 18: 42,111,440 probably null Het
Sh3tc2 A G 18: 61,989,686 D506G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Sorbs1 T C 19: 40,373,571 D123G probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Tubb6 A G 18: 67,401,924 N298D probably damaging Het
Xpo7 A T 14: 70,667,136 L1020Q probably damaging Het
Xpo7 G T 14: 70,667,137 L1020I probably benign Het
Zswim4 A T 8: 84,223,748 L611Q probably damaging Het
Other mutations in Crybg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Crybg2 APN 4 134075444 missense possibly damaging 0.57
IGL01147:Crybg2 APN 4 134089264 splice site probably null
IGL02003:Crybg2 APN 4 134072456 missense probably benign
IGL02468:Crybg2 APN 4 134082587 missense probably damaging 1.00
R0089:Crybg2 UTSW 4 134081194 missense probably damaging 1.00
R0414:Crybg2 UTSW 4 134072636 small deletion probably benign
R0579:Crybg2 UTSW 4 134072738 missense probably damaging 0.97
R0634:Crybg2 UTSW 4 134075304 splice site probably benign
R0638:Crybg2 UTSW 4 134074454 missense probably damaging 1.00
R0686:Crybg2 UTSW 4 134074526 small deletion probably benign
R1583:Crybg2 UTSW 4 134081459 missense probably damaging 1.00
R1651:Crybg2 UTSW 4 134074825 missense possibly damaging 0.84
R1651:Crybg2 UTSW 4 134074903 missense probably benign 0.07
R1752:Crybg2 UTSW 4 134073650 missense probably damaging 0.96
R1883:Crybg2 UTSW 4 134074283 nonsense probably null
R1903:Crybg2 UTSW 4 134078856 missense probably damaging 1.00
R2042:Crybg2 UTSW 4 134087533 missense possibly damaging 0.89
R2081:Crybg2 UTSW 4 134088820 missense possibly damaging 0.82
R2229:Crybg2 UTSW 4 134074526 small deletion probably benign
R2321:Crybg2 UTSW 4 134074511 missense probably benign 0.38
R2392:Crybg2 UTSW 4 134072614 missense probably benign 0.01
R2939:Crybg2 UTSW 4 134082434 missense possibly damaging 0.46
R3028:Crybg2 UTSW 4 134073784 missense probably benign 0.19
R4458:Crybg2 UTSW 4 134074894 missense probably benign 0.32
R4487:Crybg2 UTSW 4 134074201 missense probably benign 0.00
R4680:Crybg2 UTSW 4 134072718 frame shift probably null
R4681:Crybg2 UTSW 4 134072718 frame shift probably null
R4682:Crybg2 UTSW 4 134072718 frame shift probably null
R4766:Crybg2 UTSW 4 134089352 missense probably damaging 1.00
R5079:Crybg2 UTSW 4 134074253 missense possibly damaging 0.83
R5291:Crybg2 UTSW 4 134073427 missense probably benign 0.00
R5453:Crybg2 UTSW 4 134078836 critical splice acceptor site probably null
R5711:Crybg2 UTSW 4 134082627 missense probably damaging 0.97
R5834:Crybg2 UTSW 4 134074123 missense probably benign 0.12
R5969:Crybg2 UTSW 4 134075692 splice site probably null
R5976:Crybg2 UTSW 4 134074526 small deletion probably benign
R6022:Crybg2 UTSW 4 134074273 nonsense probably null
R6046:Crybg2 UTSW 4 134092077 missense probably damaging 1.00
R6088:Crybg2 UTSW 4 134075790 splice site probably null
R6196:Crybg2 UTSW 4 134081139 missense probably damaging 0.99
R6246:Crybg2 UTSW 4 134089346 missense probably damaging 0.96
R6303:Crybg2 UTSW 4 134087587 missense possibly damaging 0.66
R6320:Crybg2 UTSW 4 134081426 missense probably damaging 1.00
R6354:Crybg2 UTSW 4 134091136 missense probably benign 0.39
R6737:Crybg2 UTSW 4 134072690 missense probably damaging 0.99
R6744:Crybg2 UTSW 4 134088896 missense probably damaging 1.00
R6847:Crybg2 UTSW 4 134065546 missense probably benign 0.40
R6891:Crybg2 UTSW 4 134081837 missense probably benign 0.32
R7043:Crybg2 UTSW 4 134091136 missense probably benign 0.39
R7133:Crybg2 UTSW 4 134065443 missense probably benign 0.09
R7166:Crybg2 UTSW 4 134060882 missense probably damaging 0.96
R7412:Crybg2 UTSW 4 134074123 missense probably benign 0.12
R7711:Crybg2 UTSW 4 134065533 missense probably benign 0.00
R7745:Crybg2 UTSW 4 134088845 missense possibly damaging 0.92
R7782:Crybg2 UTSW 4 134073826 missense probably benign 0.00
R7871:Crybg2 UTSW 4 134087599 missense probably damaging 1.00
R7943:Crybg2 UTSW 4 134072984 missense probably damaging 0.97
R8008:Crybg2 UTSW 4 134091104 missense probably damaging 1.00
R8017:Crybg2 UTSW 4 134073173 missense possibly damaging 0.95
R8391:Crybg2 UTSW 4 134075724 missense probably damaging 0.97
R8510:Crybg2 UTSW 4 134073359 missense probably benign
R8535:Crybg2 UTSW 4 134081203 missense probably damaging 1.00
R8695:Crybg2 UTSW 4 134065455 missense possibly damaging 0.55
R8789:Crybg2 UTSW 4 134074243 missense probably benign 0.00
R8870:Crybg2 UTSW 4 134091214 missense possibly damaging 0.88
X0064:Crybg2 UTSW 4 134089276 missense probably damaging 0.98
Z1176:Crybg2 UTSW 4 134082660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCTTAGTTAAGGCAGGAAG -3'
(R):5'- TGTGGTCGCCCAGAAAGTTG -3'

Sequencing Primer
(F):5'- AGGTCTTGGCCAGGAGG -3'
(R):5'- CCAGAAAGTTGGGGCCTG -3'
Posted On2014-12-29