Incidental Mutation 'R2940:Slc13a1'
ID255124
Institutional Source Beutler Lab
Gene Symbol Slc13a1
Ensembl Gene ENSMUSG00000029700
Gene Namesolute carrier family 13 (sodium/sulfate symporters), member 1
SynonymsNaSi-1, Nas1
MMRRC Submission 040517-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R2940 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location24088283-24168092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24090780 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 547 (I547F)
Ref Sequence ENSEMBL: ENSMUSP00000031713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031713]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031713
AA Change: I547F

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031713
Gene: ENSMUSG00000029700
AA Change: I547F

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 5 578 9.6e-101 PFAM
Pfam:CitMHS 45 168 3.9e-14 PFAM
Pfam:CitMHS 226 521 3.9e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174594
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an apical membrane Na(+)-sulfate cotransporter involved in sulfate homeostasis in the kidney. Defects in this gene lead to many pathophysiologic problems. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice exhibit hyposulfatemia, growth retardation, reduced female fertility, and spontaneous clonic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,805 D1878G probably damaging Het
Adcy2 A G 13: 68,730,305 W405R probably damaging Het
Apc G A 18: 34,276,670 R221H probably damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Cngb1 T C 8: 95,252,107 I573V probably benign Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dmap1 G A 4: 117,676,005 T284M possibly damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif3a T C 19: 60,773,677 T487A probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam180a A T 6: 35,313,629 S140T possibly damaging Het
Fibcd1 T C 2: 31,817,264 Y327C probably damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Igfbp1 A G 11: 7,201,970 T258A probably benign Het
Isl1 T C 13: 116,308,299 T65A possibly damaging Het
Khdrbs3 T A 15: 69,049,390 D185E probably damaging Het
Klc1 C T 12: 111,806,017 R157C possibly damaging Het
Lamc3 A G 2: 31,940,702 S1484G probably benign Het
Lman1 G T 18: 65,984,273 P466Q possibly damaging Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbea C G 3: 55,934,624 E1879Q probably benign Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pigc T C 1: 161,970,670 Y74H possibly damaging Het
Plek C T 11: 16,992,887 probably null Het
Rasgrf1 C T 9: 89,991,714 A692V possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Sh3rf2 G A 18: 42,111,440 probably null Het
Sh3tc2 A G 18: 61,989,686 D506G probably damaging Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Sorbs1 T C 19: 40,373,571 D123G probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Tubb6 A G 18: 67,401,924 N298D probably damaging Het
Xpo7 A T 14: 70,667,136 L1020Q probably damaging Het
Xpo7 G T 14: 70,667,137 L1020I probably benign Het
Zswim4 A T 8: 84,223,748 L611Q probably damaging Het
Other mutations in Slc13a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slc13a1 APN 6 24118017 missense possibly damaging 0.55
IGL01096:Slc13a1 APN 6 24104077 missense probably damaging 0.97
IGL01788:Slc13a1 APN 6 24134372 missense probably damaging 0.96
IGL02028:Slc13a1 APN 6 24118031 missense probably benign 0.00
IGL02238:Slc13a1 APN 6 24103483 missense probably benign 0.00
IGL02525:Slc13a1 APN 6 24137136 missense probably damaging 1.00
IGL02741:Slc13a1 APN 6 24150708 critical splice donor site probably null
IGL02894:Slc13a1 APN 6 24137042 splice site probably benign
IGL03086:Slc13a1 APN 6 24118003 missense probably damaging 1.00
munchkin UTSW 6 24090796 nonsense probably null
R0294:Slc13a1 UTSW 6 24090780 missense possibly damaging 0.79
R0419:Slc13a1 UTSW 6 24100293 missense probably damaging 0.99
R1249:Slc13a1 UTSW 6 24133650 missense probably benign 0.01
R1401:Slc13a1 UTSW 6 24118083 splice site probably null
R1868:Slc13a1 UTSW 6 24118000 missense probably damaging 1.00
R2191:Slc13a1 UTSW 6 24134397 missense possibly damaging 0.71
R3740:Slc13a1 UTSW 6 24134477 missense probably damaging 1.00
R4326:Slc13a1 UTSW 6 24103479 missense probably benign 0.00
R4327:Slc13a1 UTSW 6 24103479 missense probably benign 0.00
R4389:Slc13a1 UTSW 6 24092398 splice site probably null
R4520:Slc13a1 UTSW 6 24134513 missense probably benign 0.18
R4771:Slc13a1 UTSW 6 24100340 nonsense probably null
R4883:Slc13a1 UTSW 6 24134357 missense probably benign 0.01
R5133:Slc13a1 UTSW 6 24103429 missense possibly damaging 0.95
R5213:Slc13a1 UTSW 6 24108159 missense probably damaging 1.00
R5310:Slc13a1 UTSW 6 24134374 missense probably benign 0.02
R5504:Slc13a1 UTSW 6 24150744 missense possibly damaging 0.83
R5971:Slc13a1 UTSW 6 24133657 missense probably benign 0.00
R6214:Slc13a1 UTSW 6 24090796 nonsense probably null
R6215:Slc13a1 UTSW 6 24090796 nonsense probably null
R6526:Slc13a1 UTSW 6 24097612 missense probably damaging 0.97
R6562:Slc13a1 UTSW 6 24150793 missense probably benign 0.35
R6573:Slc13a1 UTSW 6 24137095 missense probably damaging 1.00
R6902:Slc13a1 UTSW 6 24097666 missense possibly damaging 0.65
R7184:Slc13a1 UTSW 6 24092312 missense probably damaging 0.99
R7536:Slc13a1 UTSW 6 24100331 missense probably damaging 1.00
U15987:Slc13a1 UTSW 6 24133657 missense probably benign 0.00
Z1177:Slc13a1 UTSW 6 24133695 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCTATTTGCGAGTGCTAACG -3'
(R):5'- TCCGAGTTTGAATTCAAGCCTC -3'

Sequencing Primer
(F):5'- TGCTAACGCTAAGGGCATTC -3'
(R):5'- GCCATTCAAGTGAACCCT -3'
Posted On2014-12-29