Incidental Mutation 'R2940:Clasrp'
ID255127
Institutional Source Beutler Lab
Gene Symbol Clasrp
Ensembl Gene ENSMUSG00000061028
Gene NameCLK4-associating serine/arginine rich protein
SynonymsSrsf16, Sfrs16, SWAP2
MMRRC Submission 040517-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2940 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location19581035-19604486 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) C to A at 19585240 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086041] [ENSMUST00000108453] [ENSMUST00000207524] [ENSMUST00000207663] [ENSMUST00000207907] [ENSMUST00000208068]
Predicted Effect unknown
Transcript: ENSMUST00000086041
AA Change: R500L
SMART Domains Protein: ENSMUSP00000083205
Gene: ENSMUSG00000061028
AA Change: R500L

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
DRY_EERY 39 171 1.28e-64 SMART
low complexity region 172 212 N/A INTRINSIC
low complexity region 241 260 N/A INTRINSIC
low complexity region 263 283 N/A INTRINSIC
low complexity region 302 324 N/A INTRINSIC
low complexity region 339 368 N/A INTRINSIC
low complexity region 372 446 N/A INTRINSIC
low complexity region 453 476 N/A INTRINSIC
low complexity region 480 532 N/A INTRINSIC
coiled coil region 574 630 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108453
SMART Domains Protein: ENSMUSP00000104093
Gene: ENSMUSG00000011267

DomainStartEndE-ValueType
ZnF_C2H2 138 161 5.07e0 SMART
ZnF_C2H2 212 234 2.05e-2 SMART
ZnF_C2H2 240 262 1.1e-2 SMART
low complexity region 281 295 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
ZnF_C2H2 360 382 1.95e-3 SMART
ZnF_C2H2 388 410 3.39e-3 SMART
ZnF_C2H2 418 441 1.14e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207447
Predicted Effect probably benign
Transcript: ENSMUST00000207524
Predicted Effect probably benign
Transcript: ENSMUST00000207663
Predicted Effect unknown
Transcript: ENSMUST00000207907
AA Change: R500L
Predicted Effect unknown
Transcript: ENSMUST00000208068
AA Change: R500L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209059
Meta Mutation Damage Score 0.1079 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene contains serine/arginine (SR) dipeptide repeat domains, and is thought to be involved in the regulation of alternative splicing. This protein is thought to interact with, and be phosphorylated by, Clk4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,805 D1878G probably damaging Het
Adcy2 A G 13: 68,730,305 W405R probably damaging Het
Apc G A 18: 34,276,670 R221H probably damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Cngb1 T C 8: 95,252,107 I573V probably benign Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dmap1 G A 4: 117,676,005 T284M possibly damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif3a T C 19: 60,773,677 T487A probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam180a A T 6: 35,313,629 S140T possibly damaging Het
Fibcd1 T C 2: 31,817,264 Y327C probably damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Igfbp1 A G 11: 7,201,970 T258A probably benign Het
Isl1 T C 13: 116,308,299 T65A possibly damaging Het
Khdrbs3 T A 15: 69,049,390 D185E probably damaging Het
Klc1 C T 12: 111,806,017 R157C possibly damaging Het
Lamc3 A G 2: 31,940,702 S1484G probably benign Het
Lman1 G T 18: 65,984,273 P466Q possibly damaging Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbea C G 3: 55,934,624 E1879Q probably benign Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pigc T C 1: 161,970,670 Y74H possibly damaging Het
Plek C T 11: 16,992,887 probably null Het
Rasgrf1 C T 9: 89,991,714 A692V possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Sh3rf2 G A 18: 42,111,440 probably null Het
Sh3tc2 A G 18: 61,989,686 D506G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Sorbs1 T C 19: 40,373,571 D123G probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Tubb6 A G 18: 67,401,924 N298D probably damaging Het
Xpo7 A T 14: 70,667,136 L1020Q probably damaging Het
Xpo7 G T 14: 70,667,137 L1020I probably benign Het
Zswim4 A T 8: 84,223,748 L611Q probably damaging Het
Other mutations in Clasrp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02394:Clasrp APN 7 19603254 missense probably damaging 1.00
clarissa UTSW 7 19590248 missense possibly damaging 0.82
suet UTSW 7 19586468 utr 3 prime probably benign
R0518:Clasrp UTSW 7 19588603 missense probably benign 0.32
R0519:Clasrp UTSW 7 19584164 utr 3 prime probably benign
R0521:Clasrp UTSW 7 19588603 missense probably benign 0.32
R0626:Clasrp UTSW 7 19584493 utr 3 prime probably benign
R0826:Clasrp UTSW 7 19584301 utr 3 prime probably benign
R1918:Clasrp UTSW 7 19585263 nonsense probably null
R2044:Clasrp UTSW 7 19586715 utr 3 prime probably benign
R2256:Clasrp UTSW 7 19586585 utr 3 prime probably benign
R2257:Clasrp UTSW 7 19586585 utr 3 prime probably benign
R2870:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R2870:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R2871:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R2871:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R3408:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R3691:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R4168:Clasrp UTSW 7 19581154 unclassified probably benign
R4496:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R4505:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R4507:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R4572:Clasrp UTSW 7 19584464 splice site probably null
R4753:Clasrp UTSW 7 19594940 missense probably damaging 1.00
R4871:Clasrp UTSW 7 19590248 missense possibly damaging 0.82
R4938:Clasrp UTSW 7 19584778 splice site probably null
R5538:Clasrp UTSW 7 19584782 utr 3 prime probably benign
R5582:Clasrp UTSW 7 19586856 missense probably damaging 0.97
R5615:Clasrp UTSW 7 19586447 utr 3 prime probably benign
R5794:Clasrp UTSW 7 19591109 missense probably damaging 0.99
R5944:Clasrp UTSW 7 19594506 missense probably damaging 1.00
R6102:Clasrp UTSW 7 19586468 utr 3 prime probably benign
R6171:Clasrp UTSW 7 19584822 splice site probably benign
R6485:Clasrp UTSW 7 19586369 utr 3 prime probably benign
R6600:Clasrp UTSW 7 19590282 nonsense probably null
R7383:Clasrp UTSW 7 19585273 missense unknown
R7719:Clasrp UTSW 7 19587844 missense probably damaging 0.99
R7750:Clasrp UTSW 7 19584591 makesense probably null
R7808:Clasrp UTSW 7 19588746 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTTCATCAGGGCTCCCTCAG -3'
(R):5'- GAAAGTGCTGGACTCTGCAG -3'

Sequencing Primer
(F):5'- AGGGCTCCCTCAGAACCAG -3'
(R):5'- CAGGAGGCCTAGCGATTTG -3'
Posted On2014-12-29