Incidental Mutation 'R2940:Cngb1'
ID255132
Institutional Source Beutler Lab
Gene Symbol Cngb1
Ensembl Gene ENSMUSG00000031789
Gene Namecyclic nucleotide gated channel beta 1
SynonymsBC016201, Cngb1b, Cngb1
MMRRC Submission 040517-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2940 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location95239045-95306585 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95252107 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 573 (I573V)
Ref Sequence ENSEMBL: ENSMUSP00000112437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119870] [ENSMUST00000120044] [ENSMUST00000121162]
Predicted Effect probably benign
Transcript: ENSMUST00000119870
AA Change: I1032V

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113827
Gene: ENSMUSG00000031789
AA Change: I1032V

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
Pfam:Ion_trans 83 315 9.8e-17 PFAM
cNMP 389 508 4.1e-25 SMART
low complexity region 555 596 N/A INTRINSIC
low complexity region 599 636 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120044
AA Change: I573V

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113750
Gene: ENSMUSG00000031789
AA Change: I573V

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
transmembrane domain 79 101 N/A INTRINSIC
transmembrane domain 114 136 N/A INTRINSIC
low complexity region 169 182 N/A INTRINSIC
cNMP 389 508 4e-25 SMART
low complexity region 555 596 N/A INTRINSIC
low complexity region 599 636 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121162
AA Change: I573V

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112437
Gene: ENSMUSG00000031789
AA Change: I573V

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
transmembrane domain 79 101 N/A INTRINSIC
transmembrane domain 114 136 N/A INTRINSIC
low complexity region 169 182 N/A INTRINSIC
cNMP 389 508 4e-25 SMART
low complexity region 555 596 N/A INTRINSIC
low complexity region 599 636 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display postnatal lethality, reduced body size and weight, and retinal rod degeneration followed by cone degeneration. Mice homozygous for an allele lacking the calmodulin-binding domain exhibit defective olfactory neural signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,805 D1878G probably damaging Het
Adcy2 A G 13: 68,730,305 W405R probably damaging Het
Apc G A 18: 34,276,670 R221H probably damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dmap1 G A 4: 117,676,005 T284M possibly damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif3a T C 19: 60,773,677 T487A probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam180a A T 6: 35,313,629 S140T possibly damaging Het
Fibcd1 T C 2: 31,817,264 Y327C probably damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Igfbp1 A G 11: 7,201,970 T258A probably benign Het
Isl1 T C 13: 116,308,299 T65A possibly damaging Het
Khdrbs3 T A 15: 69,049,390 D185E probably damaging Het
Klc1 C T 12: 111,806,017 R157C possibly damaging Het
Lamc3 A G 2: 31,940,702 S1484G probably benign Het
Lman1 G T 18: 65,984,273 P466Q possibly damaging Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbea C G 3: 55,934,624 E1879Q probably benign Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pigc T C 1: 161,970,670 Y74H possibly damaging Het
Plek C T 11: 16,992,887 probably null Het
Rasgrf1 C T 9: 89,991,714 A692V possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Sh3rf2 G A 18: 42,111,440 probably null Het
Sh3tc2 A G 18: 61,989,686 D506G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Sorbs1 T C 19: 40,373,571 D123G probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Tubb6 A G 18: 67,401,924 N298D probably damaging Het
Xpo7 A T 14: 70,667,136 L1020Q probably damaging Het
Xpo7 G T 14: 70,667,137 L1020I probably benign Het
Zswim4 A T 8: 84,223,748 L611Q probably damaging Het
Other mutations in Cngb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cngb1 APN 8 95242184 splice site probably benign
IGL01575:Cngb1 APN 8 95264520 missense possibly damaging 0.51
IGL02329:Cngb1 APN 8 95242359 missense probably benign 0.14
IGL03332:Cngb1 APN 8 95298846 splice site probably benign
IGL03391:Cngb1 APN 8 95303705 unclassified probably benign
stevie UTSW 8 95260130 missense probably damaging 1.00
R0078:Cngb1 UTSW 8 95264545 critical splice acceptor site probably null
R0116:Cngb1 UTSW 8 95260638 missense probably damaging 1.00
R1073:Cngb1 UTSW 8 95303567 critical splice donor site probably null
R1166:Cngb1 UTSW 8 95260181 missense probably damaging 0.99
R1714:Cngb1 UTSW 8 95257931 missense probably damaging 1.00
R1753:Cngb1 UTSW 8 95297773 critical splice donor site probably benign
R1760:Cngb1 UTSW 8 95299700 missense probably benign 0.03
R1833:Cngb1 UTSW 8 95242355 missense probably damaging 1.00
R1935:Cngb1 UTSW 8 95299692 missense probably damaging 1.00
R1939:Cngb1 UTSW 8 95299692 missense probably damaging 1.00
R1940:Cngb1 UTSW 8 95299692 missense probably damaging 1.00
R2045:Cngb1 UTSW 8 95297085 splice site probably null
R2379:Cngb1 UTSW 8 95260130 missense probably damaging 1.00
R4034:Cngb1 UTSW 8 95264450 missense possibly damaging 0.47
R4058:Cngb1 UTSW 8 95267654 missense probably benign 0.00
R4425:Cngb1 UTSW 8 95299716 missense probably damaging 1.00
R4585:Cngb1 UTSW 8 95297128 critical splice acceptor site probably null
R4591:Cngb1 UTSW 8 95253384 missense probably damaging 1.00
R4638:Cngb1 UTSW 8 95266019 missense probably damaging 1.00
R4906:Cngb1 UTSW 8 95251973 missense probably damaging 0.96
R4950:Cngb1 UTSW 8 95248507 missense probably damaging 1.00
R4979:Cngb1 UTSW 8 95259157 missense probably damaging 0.99
R5148:Cngb1 UTSW 8 95265983 missense probably benign 0.28
R5474:Cngb1 UTSW 8 95251969 missense probably damaging 1.00
R5475:Cngb1 UTSW 8 95251969 missense probably damaging 1.00
R5545:Cngb1 UTSW 8 95252173 missense
R5585:Cngb1 UTSW 8 95263139 missense probably damaging 1.00
R5637:Cngb1 UTSW 8 95257921 missense probably damaging 1.00
R5785:Cngb1 UTSW 8 95254195 missense possibly damaging 0.90
R5967:Cngb1 UTSW 8 95251906 missense probably damaging 1.00
R6013:Cngb1 UTSW 8 95284321 unclassified probably benign
R6049:Cngb1 UTSW 8 95270842 missense probably damaging 0.99
R6370:Cngb1 UTSW 8 95264422 missense probably benign 0.33
R6377:Cngb1 UTSW 8 95248980 missense probably damaging 1.00
R6401:Cngb1 UTSW 8 95303739 unclassified probably benign
R6427:Cngb1 UTSW 8 95297759 intron probably benign
R6492:Cngb1 UTSW 8 95264424 missense probably benign 0.01
R6613:Cngb1 UTSW 8 95266010 missense possibly damaging 0.95
R6721:Cngb1 UTSW 8 95270888 missense probably benign 0.05
R6919:Cngb1 UTSW 8 95248375 missense probably null 1.00
R7012:Cngb1 UTSW 8 95257955 missense possibly damaging 0.83
R7418:Cngb1 UTSW 8 95278259 nonsense probably null
R7464:Cngb1 UTSW 8 95254183 missense possibly damaging 0.92
R7806:Cngb1 UTSW 8 95298804 critical splice donor site probably null
R8048:Cngb1 UTSW 8 95263210 missense possibly damaging 0.90
R8074:Cngb1 UTSW 8 95252173 missense
RF010:Cngb1 UTSW 8 95303650 frame shift probably null
RF053:Cngb1 UTSW 8 95303648 frame shift probably null
T0722:Cngb1 UTSW 8 95296650 missense probably benign 0.02
T0722:Cngb1 UTSW 8 95297819 missense probably damaging 0.99
T0722:Cngb1 UTSW 8 95303696 unclassified probably benign
T0722:Cngb1 UTSW 8 95303714 unclassified probably benign
Z1177:Cngb1 UTSW 8 95252136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAACGAAGCCGCTTGAG -3'
(R):5'- AGGTGATGGTGTTCCTGACAAG -3'

Sequencing Primer
(F):5'- GCATGTCGAAGATCATCTGC -3'
(R):5'- GGAACTCATAGATTCTGAAGTAGCCC -3'
Posted On2014-12-29