Incidental Mutation 'R2940:Carm1'
ID255135
Institutional Source Beutler Lab
Gene Symbol Carm1
Ensembl Gene ENSMUSG00000032185
Gene Namecoactivator-associated arginine methyltransferase 1
SynonymsPrmt4
MMRRC Submission 040517-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2940 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21546894-21592623 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 21579396 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034703] [ENSMUST00000115394] [ENSMUST00000115394] [ENSMUST00000115395] [ENSMUST00000130032]
Predicted Effect probably null
Transcript: ENSMUST00000034703
SMART Domains Protein: ENSMUSP00000034703
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2.1e-71 PFAM
Pfam:PRMT5 144 447 2.3e-16 PFAM
Pfam:MTS 166 308 2.7e-10 PFAM
Pfam:Methyltransf_9 168 318 1.1e-9 PFAM
Pfam:PrmA 173 287 2.2e-12 PFAM
Pfam:Methyltransf_31 183 325 7.4e-11 PFAM
Pfam:Methyltransf_18 185 290 5.1e-12 PFAM
Pfam:Methyltransf_26 186 287 5.3e-10 PFAM
Pfam:Methyltransf_11 190 287 8.5e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 562 576 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115394
SMART Domains Protein: ENSMUSP00000111052
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 29 140 4.7e-63 PFAM
Pfam:PRMT5 145 447 4.1e-16 PFAM
Pfam:Methyltransf_9 168 318 1.4e-9 PFAM
Pfam:MTS 170 299 2.5e-9 PFAM
Pfam:PrmA 175 287 3.7e-12 PFAM
Pfam:Methyltransf_31 183 326 1.9e-10 PFAM
Pfam:Methyltransf_18 185 290 4e-9 PFAM
Pfam:Methyltransf_11 190 287 6.5e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115394
SMART Domains Protein: ENSMUSP00000111052
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 29 140 4.7e-63 PFAM
Pfam:PRMT5 145 447 4.1e-16 PFAM
Pfam:Methyltransf_9 168 318 1.4e-9 PFAM
Pfam:MTS 170 299 2.5e-9 PFAM
Pfam:PrmA 175 287 3.7e-12 PFAM
Pfam:Methyltransf_31 183 326 1.9e-10 PFAM
Pfam:Methyltransf_18 185 290 4e-9 PFAM
Pfam:Methyltransf_11 190 287 6.5e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115395
SMART Domains Protein: ENSMUSP00000111053
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2e-71 PFAM
Pfam:PRMT5 144 447 2.1e-16 PFAM
Pfam:MTS 166 308 2.6e-10 PFAM
Pfam:Methyltransf_9 168 318 1.1e-9 PFAM
Pfam:PrmA 172 287 2.1e-12 PFAM
Pfam:Methyltransf_31 183 326 6.9e-11 PFAM
Pfam:Methyltransf_18 185 290 4.8e-12 PFAM
Pfam:Methyltransf_26 186 287 5e-10 PFAM
Pfam:Methyltransf_11 190 287 8.1e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 540 553 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130032
SMART Domains Protein: ENSMUSP00000117243
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2.8e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154049
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protein arginine methyltransferase (PRMT) family. The encoded enzyme catalyzes the methylation of guanidino nitrogens of arginyl residues of proteins. The enzyme acts specifically on histones and other chromatin-associated proteins and is involved in regulation of gene expression. The enzyme may act in association with other proteins or within multi-protein complexes and may play a role in cell type-specific functions and cell lineage specification. A related pseudogene is located on chromosome 9. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null fetuses are small and die perinatally, whereas heterozygotes are born at the expected Mendelian ratio but show decreased survival through weaning. Mice homozygous for a kinase null allele exhibit neonatal lethality, arrested T cell development, and impaired adipogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,805 D1878G probably damaging Het
Adcy2 A G 13: 68,730,305 W405R probably damaging Het
Apc G A 18: 34,276,670 R221H probably damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Cngb1 T C 8: 95,252,107 I573V probably benign Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dmap1 G A 4: 117,676,005 T284M possibly damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif3a T C 19: 60,773,677 T487A probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam180a A T 6: 35,313,629 S140T possibly damaging Het
Fibcd1 T C 2: 31,817,264 Y327C probably damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Igfbp1 A G 11: 7,201,970 T258A probably benign Het
Isl1 T C 13: 116,308,299 T65A possibly damaging Het
Khdrbs3 T A 15: 69,049,390 D185E probably damaging Het
Klc1 C T 12: 111,806,017 R157C possibly damaging Het
Lamc3 A G 2: 31,940,702 S1484G probably benign Het
Lman1 G T 18: 65,984,273 P466Q possibly damaging Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbea C G 3: 55,934,624 E1879Q probably benign Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pigc T C 1: 161,970,670 Y74H possibly damaging Het
Plek C T 11: 16,992,887 probably null Het
Rasgrf1 C T 9: 89,991,714 A692V possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Sh3rf2 G A 18: 42,111,440 probably null Het
Sh3tc2 A G 18: 61,989,686 D506G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Sorbs1 T C 19: 40,373,571 D123G probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Tubb6 A G 18: 67,401,924 N298D probably damaging Het
Xpo7 A T 14: 70,667,136 L1020Q probably damaging Het
Xpo7 G T 14: 70,667,137 L1020I probably benign Het
Zswim4 A T 8: 84,223,748 L611Q probably damaging Het
Other mutations in Carm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Carm1 APN 9 21587194 missense possibly damaging 0.62
IGL01360:Carm1 APN 9 21587302 missense probably benign 0.19
IGL01401:Carm1 APN 9 21569582 critical splice donor site probably null
IGL02218:Carm1 APN 9 21569512 missense probably damaging 1.00
IGL02436:Carm1 APN 9 21579462 missense probably damaging 1.00
IGL02601:Carm1 APN 9 21586908 missense probably damaging 1.00
R0551:Carm1 UTSW 9 21580491 splice site probably null
R0580:Carm1 UTSW 9 21583584 missense probably damaging 1.00
R0724:Carm1 UTSW 9 21587374 missense probably damaging 1.00
R0883:Carm1 UTSW 9 21569591 splice site probably benign
R1390:Carm1 UTSW 9 21579493 missense probably damaging 1.00
R1713:Carm1 UTSW 9 21586489 missense probably damaging 0.97
R1950:Carm1 UTSW 9 21574516 missense probably benign 0.01
R1960:Carm1 UTSW 9 21580310 missense probably benign 0.40
R2402:Carm1 UTSW 9 21583540 missense probably damaging 1.00
R2512:Carm1 UTSW 9 21575412 critical splice acceptor site probably null
R2520:Carm1 UTSW 9 21583597 splice site probably null
R2939:Carm1 UTSW 9 21579396 splice site probably null
R3081:Carm1 UTSW 9 21579396 splice site probably null
R3407:Carm1 UTSW 9 21586182 missense probably damaging 1.00
R3434:Carm1 UTSW 9 21569473 missense probably damaging 1.00
R3808:Carm1 UTSW 9 21586962 missense probably damaging 1.00
R4504:Carm1 UTSW 9 21569526 missense probably damaging 1.00
R4700:Carm1 UTSW 9 21587184 missense probably benign 0.12
R5019:Carm1 UTSW 9 21579511 critical splice donor site probably null
R5362:Carm1 UTSW 9 21587359 missense probably benign 0.03
R5661:Carm1 UTSW 9 21586999 missense probably benign 0.10
R5730:Carm1 UTSW 9 21580340 missense probably benign 0.37
R5913:Carm1 UTSW 9 21587552 missense probably benign 0.01
R5928:Carm1 UTSW 9 21575302 intron probably benign
R6370:Carm1 UTSW 9 21587519 missense probably benign 0.11
R6431:Carm1 UTSW 9 21583077 missense probably damaging 1.00
R6555:Carm1 UTSW 9 21586962 missense probably damaging 1.00
R7177:Carm1 UTSW 9 21547027 missense unknown
R7235:Carm1 UTSW 9 21587405 critical splice donor site probably benign
R7249:Carm1 UTSW 9 21586209 missense probably benign
R7576:Carm1 UTSW 9 21586536 critical splice donor site probably null
R7650:Carm1 UTSW 9 21580372 missense probably benign 0.00
R7664:Carm1 UTSW 9 21586990 missense probably benign 0.01
R8359:Carm1 UTSW 9 21569469 missense possibly damaging 0.51
R8683:Carm1 UTSW 9 21586168 missense possibly damaging 0.72
R8690:Carm1 UTSW 9 21569512 missense probably damaging 1.00
R8821:Carm1 UTSW 9 21580367 missense probably damaging 1.00
R8831:Carm1 UTSW 9 21580367 missense probably damaging 1.00
R8947:Carm1 UTSW 9 21586453 missense probably damaging 1.00
R8950:Carm1 UTSW 9 21579493 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTCCCACGTCAGCTA -3'
(R):5'- CGGGGCTCTCAGTGGTACA -3'

Sequencing Primer
(F):5'- AATGGGCATCAGATCTCCTG -3'
(R):5'- CAAATGAGAAGGAAGGGCTTAGACC -3'
Posted On2014-12-29