Incidental Mutation 'R2940:Dixdc1'
ID255139
Institutional Source Beutler Lab
Gene Symbol Dixdc1
Ensembl Gene ENSMUSG00000032064
Gene NameDIX domain containing 1
Synonyms4930563F16Rik, Ccd1
MMRRC Submission 040517-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2940 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location50662752-50739517 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50710959 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 25 (A25V)
Ref Sequence ENSEMBL: ENSMUSP00000113907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034566] [ENSMUST00000117093] [ENSMUST00000117646] [ENSMUST00000118707] [ENSMUST00000121634]
Predicted Effect probably damaging
Transcript: ENSMUST00000034566
AA Change: A25V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034566
Gene: ENSMUSG00000032064
AA Change: A25V

DomainStartEndE-ValueType
CH 22 151 5.48e-8 SMART
low complexity region 178 190 N/A INTRINSIC
low complexity region 237 254 N/A INTRINSIC
coiled coil region 306 338 N/A INTRINSIC
coiled coil region 359 492 N/A INTRINSIC
Pfam:DIX 627 706 1.1e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117093
AA Change: A24V

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112654
Gene: ENSMUSG00000032064
AA Change: A24V

DomainStartEndE-ValueType
Pfam:CH 22 88 3.2e-9 PFAM
Pfam:CAMSAP_CH 30 62 1.2e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117646
AA Change: A25V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112431
Gene: ENSMUSG00000032064
AA Change: A25V

DomainStartEndE-ValueType
CH 22 125 1.25e-11 SMART
low complexity region 152 164 N/A INTRINSIC
low complexity region 211 228 N/A INTRINSIC
coiled coil region 280 312 N/A INTRINSIC
coiled coil region 333 466 N/A INTRINSIC
Pfam:DIX 600 682 5.1e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118707
AA Change: A25V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113907
Gene: ENSMUSG00000032064
AA Change: A25V

DomainStartEndE-ValueType
Pfam:CH 23 89 2.3e-9 PFAM
Pfam:CAMSAP_CH 31 63 8.1e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121634
AA Change: A24V

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113089
Gene: ENSMUSG00000032064
AA Change: A24V

DomainStartEndE-ValueType
CH 21 150 5.48e-8 SMART
low complexity region 177 189 N/A INTRINSIC
low complexity region 236 253 N/A INTRINSIC
coiled coil region 305 337 N/A INTRINSIC
coiled coil region 358 491 N/A INTRINSIC
Pfam:DIX 625 707 5.3e-37 PFAM
Meta Mutation Damage Score 0.3400 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a positive regulator of the Wnt signaling pathway. The encoded protein is found associated with gamma tubulin at the centrosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced spontaneous locomotor activity, abnormal behavior in the elevated plus maze, and deficits in startle reactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,805 D1878G probably damaging Het
Adcy2 A G 13: 68,730,305 W405R probably damaging Het
Apc G A 18: 34,276,670 R221H probably damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Cngb1 T C 8: 95,252,107 I573V probably benign Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dmap1 G A 4: 117,676,005 T284M possibly damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif3a T C 19: 60,773,677 T487A probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam180a A T 6: 35,313,629 S140T possibly damaging Het
Fibcd1 T C 2: 31,817,264 Y327C probably damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Igfbp1 A G 11: 7,201,970 T258A probably benign Het
Isl1 T C 13: 116,308,299 T65A possibly damaging Het
Khdrbs3 T A 15: 69,049,390 D185E probably damaging Het
Klc1 C T 12: 111,806,017 R157C possibly damaging Het
Lamc3 A G 2: 31,940,702 S1484G probably benign Het
Lman1 G T 18: 65,984,273 P466Q possibly damaging Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbea C G 3: 55,934,624 E1879Q probably benign Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pigc T C 1: 161,970,670 Y74H possibly damaging Het
Plek C T 11: 16,992,887 probably null Het
Rasgrf1 C T 9: 89,991,714 A692V possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Sh3rf2 G A 18: 42,111,440 probably null Het
Sh3tc2 A G 18: 61,989,686 D506G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Sorbs1 T C 19: 40,373,571 D123G probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Tubb6 A G 18: 67,401,924 N298D probably damaging Het
Xpo7 A T 14: 70,667,136 L1020Q probably damaging Het
Xpo7 G T 14: 70,667,137 L1020I probably benign Het
Zswim4 A T 8: 84,223,748 L611Q probably damaging Het
Other mutations in Dixdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Dixdc1 APN 9 50667733 missense probably damaging 0.98
IGL01556:Dixdc1 APN 9 50706134 missense probably damaging 1.00
IGL01923:Dixdc1 APN 9 50695503 missense possibly damaging 0.87
IGL01933:Dixdc1 APN 9 50703258 nonsense probably null
IGL02074:Dixdc1 APN 9 50702017 missense probably benign 0.00
IGL02364:Dixdc1 APN 9 50682631 splice site probably benign
R0230:Dixdc1 UTSW 9 50695507 missense possibly damaging 0.80
R0401:Dixdc1 UTSW 9 50693674 missense possibly damaging 0.54
R0410:Dixdc1 UTSW 9 50684853 missense probably damaging 1.00
R1028:Dixdc1 UTSW 9 50703246 missense probably benign 0.02
R1083:Dixdc1 UTSW 9 50676993 intron probably benign
R1672:Dixdc1 UTSW 9 50689864 missense probably damaging 1.00
R1752:Dixdc1 UTSW 9 50682550 missense probably benign
R2213:Dixdc1 UTSW 9 50701945 missense probably benign 0.01
R2289:Dixdc1 UTSW 9 50683872 critical splice donor site probably null
R2939:Dixdc1 UTSW 9 50710959 missense probably damaging 0.98
R3081:Dixdc1 UTSW 9 50710959 missense probably damaging 0.98
R4982:Dixdc1 UTSW 9 50682602 missense possibly damaging 0.89
R5250:Dixdc1 UTSW 9 50683735 missense possibly damaging 0.88
R5581:Dixdc1 UTSW 9 50669480 missense probably damaging 1.00
R5914:Dixdc1 UTSW 9 50698588 intron probably benign
R6228:Dixdc1 UTSW 9 50703356 splice site probably null
R6346:Dixdc1 UTSW 9 50683953 missense probably damaging 1.00
R6370:Dixdc1 UTSW 9 50682223 splice site probably null
R7036:Dixdc1 UTSW 9 50682564 missense probably benign 0.03
R7074:Dixdc1 UTSW 9 50689914 missense possibly damaging 0.83
R7361:Dixdc1 UTSW 9 50688653 missense probably damaging 0.99
R7734:Dixdc1 UTSW 9 50701968 missense probably damaging 1.00
R8292:Dixdc1 UTSW 9 50710689 missense probably benign 0.03
R8318:Dixdc1 UTSW 9 50684409 critical splice acceptor site probably null
R8353:Dixdc1 UTSW 9 50684886 missense probably benign 0.24
R8453:Dixdc1 UTSW 9 50684886 missense probably benign 0.24
R8462:Dixdc1 UTSW 9 50710779 nonsense probably null
R8810:Dixdc1 UTSW 9 50701965 missense probably damaging 1.00
R8871:Dixdc1 UTSW 9 50683796 missense possibly damaging 0.89
R8872:Dixdc1 UTSW 9 50703153 missense possibly damaging 0.77
RF016:Dixdc1 UTSW 9 50693641 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAACAACCTGCTTTGAAGGG -3'
(R):5'- CCTGCGTGTCAACCTAAAGC -3'

Sequencing Primer
(F):5'- CAACCTGCTTTGAAGGGCGAATG -3'
(R):5'- AAGCTAGGGATTTTGGAACATGCTC -3'
Posted On2014-12-29