Incidental Mutation 'R2940:Rasgrf1'
ID255141
Institutional Source Beutler Lab
Gene Symbol Rasgrf1
Ensembl Gene ENSMUSG00000032356
Gene NameRAS protein-specific guanine nucleotide-releasing factor 1
SynonymsCDC25, Grfbeta, CDC25Mm, Grf1
MMRRC Submission 040517-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2940 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location89909908-90026977 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89991714 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 692 (A692V)
Ref Sequence ENSEMBL: ENSMUSP00000034912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034912]
PDB Structure Crystal Structure of the Cdc25 domain of RasGRF1 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034912
AA Change: A692V

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034912
Gene: ENSMUSG00000032356
AA Change: A692V

DomainStartEndE-ValueType
PH 23 132 2.48e-18 SMART
Blast:RhoGEF 146 196 4e-6 BLAST
IQ 205 227 5.27e0 SMART
RhoGEF 248 429 1.96e-57 SMART
PH 461 590 1.51e-8 SMART
RasGEFN 634 767 3.07e-10 SMART
low complexity region 844 855 N/A INTRINSIC
RasGEFN 869 997 5.86e-7 SMART
RasGEF 1023 1260 1.85e-99 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) similar to the Saccharomyces cerevisiae CDC25 gene product. Functional analysis has demonstrated that this protein stimulates the dissociation of GDP from RAS protein. The studies of the similar gene in mouse suggested that the Ras-GEF activity of this protein in brain can be activated by Ca2+ influx, muscarinic receptors, and G protein beta-gamma subunit. Mouse studies also indicated that the Ras-GEF signaling pathway mediated by this protein may be important for long-term memory. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for null mutations (and heterozygotes with a paternally inherited mutant allele) exhibit reduced postnatal growth, low insulin and IGF I levels, glucose intolerance, beta-cell hypoplasia, impaired long-term synaptic plasticity, and impaired hippocampal-dependent learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,805 D1878G probably damaging Het
Adcy2 A G 13: 68,730,305 W405R probably damaging Het
Apc G A 18: 34,276,670 R221H probably damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Cngb1 T C 8: 95,252,107 I573V probably benign Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dmap1 G A 4: 117,676,005 T284M possibly damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif3a T C 19: 60,773,677 T487A probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam180a A T 6: 35,313,629 S140T possibly damaging Het
Fibcd1 T C 2: 31,817,264 Y327C probably damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Igfbp1 A G 11: 7,201,970 T258A probably benign Het
Isl1 T C 13: 116,308,299 T65A possibly damaging Het
Khdrbs3 T A 15: 69,049,390 D185E probably damaging Het
Klc1 C T 12: 111,806,017 R157C possibly damaging Het
Lamc3 A G 2: 31,940,702 S1484G probably benign Het
Lman1 G T 18: 65,984,273 P466Q possibly damaging Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbea C G 3: 55,934,624 E1879Q probably benign Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pigc T C 1: 161,970,670 Y74H possibly damaging Het
Plek C T 11: 16,992,887 probably null Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Sh3rf2 G A 18: 42,111,440 probably null Het
Sh3tc2 A G 18: 61,989,686 D506G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Sorbs1 T C 19: 40,373,571 D123G probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Tubb6 A G 18: 67,401,924 N298D probably damaging Het
Xpo7 A T 14: 70,667,136 L1020Q probably damaging Het
Xpo7 G T 14: 70,667,137 L1020I probably benign Het
Zswim4 A T 8: 84,223,748 L611Q probably damaging Het
Other mutations in Rasgrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Rasgrf1 APN 9 89970481 missense probably damaging 1.00
IGL00763:Rasgrf1 APN 9 89971020 missense probably benign 0.05
IGL01336:Rasgrf1 APN 9 89991530 missense probably benign 0.00
IGL01710:Rasgrf1 APN 9 89991692 missense probably benign 0.18
IGL01807:Rasgrf1 APN 9 89991513 missense probably damaging 0.99
IGL01939:Rasgrf1 APN 9 89974836 missense probably damaging 0.99
IGL02453:Rasgrf1 APN 9 89944760 missense possibly damaging 0.76
IGL02961:Rasgrf1 APN 9 89981649 missense possibly damaging 0.88
IGL03009:Rasgrf1 APN 9 89991703 missense possibly damaging 0.75
IGL03369:Rasgrf1 APN 9 90010451 missense probably damaging 1.00
IGL03373:Rasgrf1 APN 9 90017031 splice site probably benign
Malenkiy UTSW 9 90010484 splice site probably null
Pigeon UTSW 9 89967915 missense probably damaging 1.00
PIT4142001:Rasgrf1 UTSW 9 89915573 missense possibly damaging 0.91
R0234:Rasgrf1 UTSW 9 90009366 missense probably damaging 1.00
R0629:Rasgrf1 UTSW 9 89984269 missense probably damaging 1.00
R0685:Rasgrf1 UTSW 9 89915482 utr 3 prime probably benign
R0730:Rasgrf1 UTSW 9 89951009 splice site probably benign
R0835:Rasgrf1 UTSW 9 90000771 missense probably benign
R1432:Rasgrf1 UTSW 9 90012800 missense probably benign 0.35
R1647:Rasgrf1 UTSW 9 89953920 missense probably benign 0.28
R1717:Rasgrf1 UTSW 9 89953913 missense probably damaging 0.98
R1933:Rasgrf1 UTSW 9 89953913 missense probably damaging 0.98
R1934:Rasgrf1 UTSW 9 89953913 missense probably damaging 0.98
R2187:Rasgrf1 UTSW 9 89994835 missense possibly damaging 0.93
R2240:Rasgrf1 UTSW 9 89976762 missense probably damaging 0.99
R3949:Rasgrf1 UTSW 9 89981744 splice site probably benign
R4751:Rasgrf1 UTSW 9 89910118 missense probably damaging 1.00
R4751:Rasgrf1 UTSW 9 90012866 missense probably damaging 1.00
R4901:Rasgrf1 UTSW 9 89995003 missense probably benign 0.00
R4910:Rasgrf1 UTSW 9 89976752 missense probably benign 0.00
R4961:Rasgrf1 UTSW 9 89944869 missense probably benign 0.06
R5270:Rasgrf1 UTSW 9 90026694 missense probably benign 0.00
R5320:Rasgrf1 UTSW 9 90020425 missense probably damaging 0.99
R5602:Rasgrf1 UTSW 9 89911571 missense possibly damaging 0.73
R5659:Rasgrf1 UTSW 9 89984289 missense probably damaging 1.00
R5960:Rasgrf1 UTSW 9 90021384 missense possibly damaging 0.69
R6074:Rasgrf1 UTSW 9 89953915 missense probably benign 0.01
R6400:Rasgrf1 UTSW 9 89991630 missense probably damaging 1.00
R6596:Rasgrf1 UTSW 9 90012794 missense possibly damaging 0.92
R6603:Rasgrf1 UTSW 9 89910257 missense probably damaging 0.96
R6647:Rasgrf1 UTSW 9 90010463 missense probably benign 0.00
R6813:Rasgrf1 UTSW 9 90010484 splice site probably null
R7136:Rasgrf1 UTSW 9 89991598 missense probably damaging 1.00
R7155:Rasgrf1 UTSW 9 90002361 missense possibly damaging 0.90
R7175:Rasgrf1 UTSW 9 89980749 missense probably benign 0.02
R7202:Rasgrf1 UTSW 9 90017072 missense possibly damaging 0.49
R7219:Rasgrf1 UTSW 9 89984288 missense probably damaging 1.00
R7244:Rasgrf1 UTSW 9 89994757 missense probably damaging 1.00
R7733:Rasgrf1 UTSW 9 89981727 missense probably benign 0.01
R7764:Rasgrf1 UTSW 9 89994694 missense possibly damaging 0.94
R8210:Rasgrf1 UTSW 9 89911622 missense unknown
R8421:Rasgrf1 UTSW 9 89967915 missense probably damaging 1.00
R8524:Rasgrf1 UTSW 9 89915585 missense possibly damaging 0.53
R8526:Rasgrf1 UTSW 9 89974848 missense probably damaging 0.96
R8697:Rasgrf1 UTSW 9 89995002 missense probably benign
Z1177:Rasgrf1 UTSW 9 89950917 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTTCAGATCCGCTATGC -3'
(R):5'- CCTTATGGGCTGAGAAATATGTGG -3'

Sequencing Primer
(F):5'- GCTATGCCAGCGTGGAG -3'
(R):5'- GGTGCATGGTCCCAGTAG -3'
Posted On2014-12-29