Incidental Mutation 'R2940:Plek'
ID255145
Institutional Source Beutler Lab
Gene Symbol Plek
Ensembl Gene ENSMUSG00000020120
Gene Namepleckstrin
Synonyms
MMRRC Submission 040517-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R2940 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location16971206-17052381 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 16992887 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020321] [ENSMUST00000102881] [ENSMUST00000156101]
PDB Structure Solution structure of the DEP domain of mouse pleckstrin [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000020321
SMART Domains Protein: ENSMUSP00000020321
Gene: ENSMUSG00000020120

DomainStartEndE-ValueType
PH 1 80 1.12e-2 SMART
DEP 113 198 2.53e-16 SMART
PH 222 326 5.96e-21 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102881
SMART Domains Protein: ENSMUSP00000099945
Gene: ENSMUSG00000020120

DomainStartEndE-ValueType
PH 5 103 7.12e-19 SMART
DEP 136 221 2.53e-16 SMART
PH 245 349 5.96e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156101
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display mild thrombocytopenia, impaired platelet aggregation, and impaired platelet granule secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,805 D1878G probably damaging Het
Adcy2 A G 13: 68,730,305 W405R probably damaging Het
Apc G A 18: 34,276,670 R221H probably damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Cngb1 T C 8: 95,252,107 I573V probably benign Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dmap1 G A 4: 117,676,005 T284M possibly damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif3a T C 19: 60,773,677 T487A probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam180a A T 6: 35,313,629 S140T possibly damaging Het
Fibcd1 T C 2: 31,817,264 Y327C probably damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Igfbp1 A G 11: 7,201,970 T258A probably benign Het
Isl1 T C 13: 116,308,299 T65A possibly damaging Het
Khdrbs3 T A 15: 69,049,390 D185E probably damaging Het
Klc1 C T 12: 111,806,017 R157C possibly damaging Het
Lamc3 A G 2: 31,940,702 S1484G probably benign Het
Lman1 G T 18: 65,984,273 P466Q possibly damaging Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbea C G 3: 55,934,624 E1879Q probably benign Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pigc T C 1: 161,970,670 Y74H possibly damaging Het
Rasgrf1 C T 9: 89,991,714 A692V possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Sh3rf2 G A 18: 42,111,440 probably null Het
Sh3tc2 A G 18: 61,989,686 D506G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Sorbs1 T C 19: 40,373,571 D123G probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Tubb6 A G 18: 67,401,924 N298D probably damaging Het
Xpo7 A T 14: 70,667,136 L1020Q probably damaging Het
Xpo7 G T 14: 70,667,137 L1020I probably benign Het
Zswim4 A T 8: 84,223,748 L611Q probably damaging Het
Other mutations in Plek
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02350:Plek APN 11 16981846 missense probably damaging 1.00
IGL02357:Plek APN 11 16981846 missense probably damaging 1.00
IGL02982:Plek APN 11 16981826 missense probably damaging 1.00
IGL03184:Plek APN 11 16981887 missense probably benign
IGL03243:Plek APN 11 16995319 missense possibly damaging 0.47
PIT4402001:Plek UTSW 11 16990121 missense probably benign
R0025:Plek UTSW 11 16985594 missense probably damaging 1.00
R1756:Plek UTSW 11 16992901 missense probably damaging 1.00
R1881:Plek UTSW 11 16990111 missense probably benign 0.08
R3426:Plek UTSW 11 16990142 missense probably damaging 0.99
R4436:Plek UTSW 11 16992972 missense probably damaging 0.97
R4463:Plek UTSW 11 16981873 missense possibly damaging 0.95
R4475:Plek UTSW 11 16985528 critical splice donor site probably null
R4998:Plek UTSW 11 16983194 critical splice donor site probably null
R5050:Plek UTSW 11 16995216 missense probably damaging 0.98
R6108:Plek UTSW 11 16990058 missense probably damaging 0.98
R6159:Plek UTSW 11 16985539 missense probably damaging 0.96
R6185:Plek UTSW 11 16981829 missense probably damaging 1.00
R7011:Plek UTSW 11 16994760 missense possibly damaging 0.86
R7017:Plek UTSW 11 17052220 start gained probably benign
R7317:Plek UTSW 11 16994739 missense probably benign 0.06
R7890:Plek UTSW 11 16995238 missense probably benign
R8334:Plek UTSW 11 16983220 missense probably benign 0.09
R8440:Plek UTSW 11 16995276 missense possibly damaging 0.87
R8679:Plek UTSW 11 16994676 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGCAGTACATCGAGCTGTG -3'
(R):5'- CTTGTGAAGGCCCATCTGAG -3'

Sequencing Primer
(F):5'- GAGCTGTGCCCCTTTCCAATAC -3'
(R):5'- AAGGCCCATCTGAGGTAGTTCAC -3'
Posted On2014-12-29