Incidental Mutation 'R2940:Trpv1'
ID255147
Institutional Source Beutler Lab
Gene Symbol Trpv1
Ensembl Gene ENSMUSG00000005952
Gene Nametransient receptor potential cation channel, subfamily V, member 1
SynonymsOTRPC1, VR-1, capsaicin receptor, Vr1
MMRRC Submission 040517-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R2940 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73234292-73261242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73254849 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 403 (K403R)
Ref Sequence ENSEMBL: ENSMUSP00000104110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006106] [ENSMUST00000102526] [ENSMUST00000108470] [ENSMUST00000138853]
Predicted Effect probably benign
Transcript: ENSMUST00000006106
AA Change: K711R

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000006106
Gene: ENSMUSG00000005952
AA Change: K711R

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
ANK 154 186 1.6e2 SMART
ANK 201 230 5.62e-4 SMART
ANK 248 277 2.3e0 SMART
Blast:ANK 285 321 4e-8 BLAST
Blast:ANK 334 370 6e-9 BLAST
PDB:3J5R|D 339 660 N/A PDB
Blast:PHB 658 704 1e-8 BLAST
PDB:3SUI|B 708 742 1e-15 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000102526
AA Change: K771R

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099585
Gene: ENSMUSG00000005952
AA Change: K771R

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
ANK 154 186 1.6e2 SMART
ANK 201 230 5.62e-4 SMART
ANK 248 277 2.3e0 SMART
Blast:ANK 285 321 5e-8 BLAST
ANK 333 363 6.17e-1 SMART
Pfam:Ion_trans 432 695 3e-12 PFAM
Blast:PHB 718 764 1e-8 BLAST
PDB:3SUI|B 768 802 1e-15 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000108470
AA Change: K403R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104110
Gene: ENSMUSG00000005952
AA Change: K403R

DomainStartEndE-ValueType
Blast:ANK 26 62 4e-9 BLAST
Pfam:Ion_trans 111 315 1.8e-8 PFAM
Blast:PHB 350 396 6e-9 BLAST
PDB:3SUI|B 400 434 1e-15 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128113
Predicted Effect probably benign
Transcript: ENSMUST00000138853
AA Change: K463R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000116400
Gene: ENSMUSG00000005952
AA Change: K463R

DomainStartEndE-ValueType
ANK 25 55 6.17e-1 SMART
Pfam:Ion_trans 171 375 1.8e-8 PFAM
Blast:PHB 410 456 6e-9 BLAST
Meta Mutation Damage Score 0.1245 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Capsaicin, the main pungent ingredient in hot chili peppers, elicits a sensation of burning pain by selectively activating sensory neurons that convey information about noxious stimuli to the central nervous system. The protein encoded by this gene is a receptor for capsaicin and is a non-selective cation channel that is structurally related to members of the TRP family of ion channels. This receptor is also activated by increases in temperature in the noxious range, suggesting that it functions as a transducer of painful thermal stimuli in vivo. Four transcript variants encoding the same protein, but with different 5' UTR sequence, have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice demonstrate abnormal nociception, abnormal anxiety- and conditioning-related behaviors, increased sensitivity to DOCA-salt-induced renal damage, resistance to diet-induced obesity, altered taste sensitivity, and impaired febrile response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,805 D1878G probably damaging Het
Adcy2 A G 13: 68,730,305 W405R probably damaging Het
Apc G A 18: 34,276,670 R221H probably damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Cngb1 T C 8: 95,252,107 I573V probably benign Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dmap1 G A 4: 117,676,005 T284M possibly damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif3a T C 19: 60,773,677 T487A probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam180a A T 6: 35,313,629 S140T possibly damaging Het
Fibcd1 T C 2: 31,817,264 Y327C probably damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Igfbp1 A G 11: 7,201,970 T258A probably benign Het
Isl1 T C 13: 116,308,299 T65A possibly damaging Het
Khdrbs3 T A 15: 69,049,390 D185E probably damaging Het
Klc1 C T 12: 111,806,017 R157C possibly damaging Het
Lamc3 A G 2: 31,940,702 S1484G probably benign Het
Lman1 G T 18: 65,984,273 P466Q possibly damaging Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbea C G 3: 55,934,624 E1879Q probably benign Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pigc T C 1: 161,970,670 Y74H possibly damaging Het
Plek C T 11: 16,992,887 probably null Het
Rasgrf1 C T 9: 89,991,714 A692V possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Sh3rf2 G A 18: 42,111,440 probably null Het
Sh3tc2 A G 18: 61,989,686 D506G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Sorbs1 T C 19: 40,373,571 D123G probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Tubb6 A G 18: 67,401,924 N298D probably damaging Het
Xpo7 A T 14: 70,667,136 L1020Q probably damaging Het
Xpo7 G T 14: 70,667,137 L1020I probably benign Het
Zswim4 A T 8: 84,223,748 L611Q probably damaging Het
Other mutations in Trpv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Trpv1 APN 11 73260362 missense probably damaging 0.99
IGL01348:Trpv1 APN 11 73238252 unclassified probably null
IGL01568:Trpv1 APN 11 73238443 missense probably benign 0.01
IGL01638:Trpv1 APN 11 73253329 missense probably damaging 0.98
IGL02092:Trpv1 APN 11 73246079 splice site probably benign
IGL02167:Trpv1 APN 11 73254797 missense probably damaging 1.00
IGL02649:Trpv1 APN 11 73250786 missense probably damaging 1.00
IGL03396:Trpv1 APN 11 73253056 missense probably benign 0.01
IGL03402:Trpv1 APN 11 73239637 missense possibly damaging 0.73
R0112:Trpv1 UTSW 11 73253272 missense probably damaging 1.00
R0433:Trpv1 UTSW 11 73253008 splice site probably benign
R0482:Trpv1 UTSW 11 73239429 missense probably damaging 1.00
R0494:Trpv1 UTSW 11 73260442 missense probably benign
R1401:Trpv1 UTSW 11 73240126 splice site probably null
R2032:Trpv1 UTSW 11 73238385 missense probably benign
R2199:Trpv1 UTSW 11 73240251 missense probably damaging 0.96
R2263:Trpv1 UTSW 11 73241682 missense probably damaging 1.00
R2939:Trpv1 UTSW 11 73254849 missense probably damaging 0.99
R3743:Trpv1 UTSW 11 73254302 missense probably damaging 1.00
R3805:Trpv1 UTSW 11 73253053 missense probably damaging 0.99
R4073:Trpv1 UTSW 11 73250780 missense probably damaging 0.96
R4294:Trpv1 UTSW 11 73240464 missense probably damaging 1.00
R4650:Trpv1 UTSW 11 73238263 missense probably benign 0.04
R4700:Trpv1 UTSW 11 73251284 missense possibly damaging 0.47
R5114:Trpv1 UTSW 11 73241748 missense probably damaging 1.00
R5153:Trpv1 UTSW 11 73238516 missense probably benign 0.32
R5319:Trpv1 UTSW 11 73239589 missense probably damaging 0.99
R5516:Trpv1 UTSW 11 73245983 missense probably benign 0.44
R5845:Trpv1 UTSW 11 73240581 missense probably damaging 1.00
R6134:Trpv1 UTSW 11 73244317 missense probably benign 0.01
R6232:Trpv1 UTSW 11 73250810 missense possibly damaging 0.88
R6383:Trpv1 UTSW 11 73246036 missense probably damaging 1.00
R7200:Trpv1 UTSW 11 73239586 missense probably damaging 1.00
R7319:Trpv1 UTSW 11 73250794 missense probably benign 0.01
R7323:Trpv1 UTSW 11 73260337 missense possibly damaging 0.82
R7361:Trpv1 UTSW 11 73260377 missense probably damaging 0.99
R7373:Trpv1 UTSW 11 73240673 missense probably damaging 1.00
R7444:Trpv1 UTSW 11 73244204 missense possibly damaging 0.89
R7488:Trpv1 UTSW 11 73238529 missense probably benign 0.00
R7513:Trpv1 UTSW 11 73240541 missense probably damaging 1.00
R7762:Trpv1 UTSW 11 73254222 missense probably benign 0.01
R8213:Trpv1 UTSW 11 73254251 missense probably damaging 1.00
R8261:Trpv1 UTSW 11 73254767 critical splice acceptor site probably null
X0067:Trpv1 UTSW 11 73244201 critical splice acceptor site probably null
Z1176:Trpv1 UTSW 11 73240188 missense probably damaging 1.00
Z1176:Trpv1 UTSW 11 73240507 missense probably damaging 1.00
Z1177:Trpv1 UTSW 11 73254773 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGGTTTAAAATTCTTGGGC -3'
(R):5'- GGCATATACCAGTCACTAAGCG -3'

Sequencing Primer
(F):5'- GGTGTCTATAAAATAAGCCCTGGC -3'
(R):5'- TCACTAAGCGTGGCCGAGTG -3'
Posted On2014-12-29