Incidental Mutation 'R2940:Elmsan1'
ID255148
Institutional Source Beutler Lab
Gene Symbol Elmsan1
Ensembl Gene ENSMUSG00000042507
Gene NameELM2 and Myb/SANT-like domain containing 1
Synonyms9430029N19Rik, C130039O16Rik
MMRRC Submission 040517-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.457) question?
Stock #R2940 (G1)
Quality Score216
Status Not validated
Chromosome12
Chromosomal Location84149176-84218881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84156471 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 886 (G886S)
Ref Sequence ENSEMBL: ENSMUSP00000105923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046266] [ENSMUST00000110294] [ENSMUST00000220974]
Predicted Effect probably benign
Transcript: ENSMUST00000046266
AA Change: G886S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048120
Gene: ENSMUSG00000042507
AA Change: G886S

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 107 117 N/A INTRINSIC
low complexity region 124 132 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
low complexity region 377 388 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
ELM2 715 772 6.76e-14 SMART
low complexity region 798 814 N/A INTRINSIC
SANT 821 869 1.44e-5 SMART
low complexity region 906 926 N/A INTRINSIC
low complexity region 942 956 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.72e-2 SMART
low complexity region 1053 1082 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110294
AA Change: G886S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105923
Gene: ENSMUSG00000042507
AA Change: G886S

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 107 117 N/A INTRINSIC
low complexity region 124 132 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
low complexity region 377 388 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
ELM2 715 772 6.76e-14 SMART
low complexity region 798 814 N/A INTRINSIC
SANT 821 869 1.44e-5 SMART
low complexity region 906 926 N/A INTRINSIC
low complexity region 942 956 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.72e-2 SMART
low complexity region 1053 1082 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137562
Predicted Effect probably benign
Transcript: ENSMUST00000220974
AA Change: G886S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,805 D1878G probably damaging Het
Adcy2 A G 13: 68,730,305 W405R probably damaging Het
Apc G A 18: 34,276,670 R221H probably damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Cngb1 T C 8: 95,252,107 I573V probably benign Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dmap1 G A 4: 117,676,005 T284M possibly damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif3a T C 19: 60,773,677 T487A probably benign Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam180a A T 6: 35,313,629 S140T possibly damaging Het
Fibcd1 T C 2: 31,817,264 Y327C probably damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Igfbp1 A G 11: 7,201,970 T258A probably benign Het
Isl1 T C 13: 116,308,299 T65A possibly damaging Het
Khdrbs3 T A 15: 69,049,390 D185E probably damaging Het
Klc1 C T 12: 111,806,017 R157C possibly damaging Het
Lamc3 A G 2: 31,940,702 S1484G probably benign Het
Lman1 G T 18: 65,984,273 P466Q possibly damaging Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbea C G 3: 55,934,624 E1879Q probably benign Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pigc T C 1: 161,970,670 Y74H possibly damaging Het
Plek C T 11: 16,992,887 probably null Het
Rasgrf1 C T 9: 89,991,714 A692V possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Sh3rf2 G A 18: 42,111,440 probably null Het
Sh3tc2 A G 18: 61,989,686 D506G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Sorbs1 T C 19: 40,373,571 D123G probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Tubb6 A G 18: 67,401,924 N298D probably damaging Het
Xpo7 A T 14: 70,667,136 L1020Q probably damaging Het
Xpo7 G T 14: 70,667,137 L1020I probably benign Het
Zswim4 A T 8: 84,223,748 L611Q probably damaging Het
Other mutations in Elmsan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Elmsan1 APN 12 84172855 nonsense probably null
IGL00913:Elmsan1 APN 12 84172858 missense probably benign
IGL00944:Elmsan1 APN 12 84160548 splice site probably benign
IGL01108:Elmsan1 APN 12 84173691 missense probably damaging 1.00
IGL01952:Elmsan1 APN 12 84173266 missense probably benign 0.00
IGL01961:Elmsan1 APN 12 84173614 missense probably damaging 1.00
IGL02188:Elmsan1 APN 12 84162326 missense probably benign 0.00
IGL02700:Elmsan1 APN 12 84152862 missense probably benign 0.06
R0645:Elmsan1 UTSW 12 84158303 missense possibly damaging 0.71
R1387:Elmsan1 UTSW 12 84152931 missense probably damaging 0.98
R1740:Elmsan1 UTSW 12 84172902 missense probably damaging 0.99
R1769:Elmsan1 UTSW 12 84158350 splice site probably benign
R1795:Elmsan1 UTSW 12 84158974 critical splice donor site probably null
R2146:Elmsan1 UTSW 12 84173035 missense probably damaging 0.99
R2872:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R2872:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R3408:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R3689:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R3691:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R3840:Elmsan1 UTSW 12 84171609 missense probably damaging 0.99
R4364:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R4366:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R4392:Elmsan1 UTSW 12 84173111 missense probably benign 0.10
R4439:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R4440:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R4496:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R5227:Elmsan1 UTSW 12 84152887 missense probably benign 0.10
R6921:Elmsan1 UTSW 12 84156459 missense probably damaging 0.99
R7675:Elmsan1 UTSW 12 84173800 missense probably damaging 1.00
R8956:Elmsan1 UTSW 12 84162328 missense probably benign
Z1176:Elmsan1 UTSW 12 84173499 missense probably damaging 0.99
Z1176:Elmsan1 UTSW 12 84173501 missense probably damaging 0.98
Z1177:Elmsan1 UTSW 12 84152991 missense probably benign 0.01
Z1177:Elmsan1 UTSW 12 84162358 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGTTCAGCATCAGCACCATC -3'
(R):5'- CCTAAGGCTTAAAGGGAACGTG -3'

Sequencing Primer
(F):5'- TCGATACCGGAGAGAGCTC -3'
(R):5'- CTAAGGCTTAAAGGGAACGTGAAGAG -3'
Posted On2014-12-29