Incidental Mutation 'R2940:Isl1'
ID255150
Institutional Source Beutler Lab
Gene Symbol Isl1
Ensembl Gene ENSMUSG00000042258
Gene NameISL1 transcription factor, LIM/homeodomain
SynonymsIslet 1
MMRRC Submission 040517-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2940 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location116298281-116309689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116308299 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 65 (T65A)
Ref Sequence ENSEMBL: ENSMUSP00000135567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036060] [ENSMUST00000176044]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036060
AA Change: T65A

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000044879
Gene: ENSMUSG00000042258
AA Change: T65A

DomainStartEndE-ValueType
LIM 16 70 1.39e-13 SMART
LIM 78 132 4.99e-15 SMART
HOX 181 243 1.83e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000176044
AA Change: T65A

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135567
Gene: ENSMUSG00000042258
AA Change: T65A

DomainStartEndE-ValueType
LIM 16 70 1.39e-13 SMART
LIM 78 132 4.99e-15 SMART
HOX 181 243 1.83e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176812
SMART Domains Protein: ENSMUSP00000135793
Gene: ENSMUSG00000042258

DomainStartEndE-ValueType
LIM 1 40 1.3e-5 SMART
HOX 89 151 9.4e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195602
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LIM/homeodomain family of transcription factors. The encoded protein binds to the enhancer region of the insulin gene, among others, and may play an important role in regulating insulin gene expression. The encoded protein is central to the development of pancreatic cell lineages and may also be required for motor neuron generation. Mutations in this gene have been associated with maturity-onset diabetes of the young. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation fail to develop motor neurons and die by embryonic day 11.5 with abnormal heart and pancreas development. Mice heterozygous for an ENU mutation exhibit chronic otitis media and hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,805 D1878G probably damaging Het
Adcy2 A G 13: 68,730,305 W405R probably damaging Het
Apc G A 18: 34,276,670 R221H probably damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Cngb1 T C 8: 95,252,107 I573V probably benign Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dmap1 G A 4: 117,676,005 T284M possibly damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif3a T C 19: 60,773,677 T487A probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam180a A T 6: 35,313,629 S140T possibly damaging Het
Fibcd1 T C 2: 31,817,264 Y327C probably damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Igfbp1 A G 11: 7,201,970 T258A probably benign Het
Khdrbs3 T A 15: 69,049,390 D185E probably damaging Het
Klc1 C T 12: 111,806,017 R157C possibly damaging Het
Lamc3 A G 2: 31,940,702 S1484G probably benign Het
Lman1 G T 18: 65,984,273 P466Q possibly damaging Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbea C G 3: 55,934,624 E1879Q probably benign Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pigc T C 1: 161,970,670 Y74H possibly damaging Het
Plek C T 11: 16,992,887 probably null Het
Rasgrf1 C T 9: 89,991,714 A692V possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Sh3rf2 G A 18: 42,111,440 probably null Het
Sh3tc2 A G 18: 61,989,686 D506G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Sorbs1 T C 19: 40,373,571 D123G probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Tubb6 A G 18: 67,401,924 N298D probably damaging Het
Xpo7 A T 14: 70,667,136 L1020Q probably damaging Het
Xpo7 G T 14: 70,667,137 L1020I probably benign Het
Zswim4 A T 8: 84,223,748 L611Q probably damaging Het
Other mutations in Isl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Isl1 APN 13 116303053 missense probably benign 0.02
IGL03251:Isl1 APN 13 116305449 missense probably benign
R1897:Isl1 UTSW 13 116303330 missense probably benign 0.12
R1928:Isl1 UTSW 13 116308417 missense probably damaging 1.00
R4062:Isl1 UTSW 13 116303090 missense probably benign 0.27
R4795:Isl1 UTSW 13 116305430 missense probably benign 0.41
R4796:Isl1 UTSW 13 116305430 missense probably benign 0.41
R4836:Isl1 UTSW 13 116303083 missense probably benign 0.06
R4839:Isl1 UTSW 13 116301684 missense probably damaging 1.00
R4870:Isl1 UTSW 13 116308270 splice site probably benign
R5231:Isl1 UTSW 13 116301657 missense probably benign 0.17
R6220:Isl1 UTSW 13 116303267 missense probably benign 0.24
R7231:Isl1 UTSW 13 116303290 missense probably benign 0.06
R8191:Isl1 UTSW 13 116305418 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCCTTAGGGAAGTTTAAAGAGGG -3'
(R):5'- GAAGTAAACGGTTAGTCAATCATGC -3'

Sequencing Primer
(F):5'- TTTATGAAACACAGCGACACC -3'
(R):5'- GCGGCAATCAAATTCACG -3'
Posted On2014-12-29