Incidental Mutation 'R2940:Xpo7'
ID255152
Institutional Source Beutler Lab
Gene Symbol Xpo7
Ensembl Gene ENSMUSG00000022100
Gene Nameexportin 7
Synonyms4930506C02Rik, Ranbp16
MMRRC Submission 040517-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R2940 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location70654246-70766628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70667136 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1020 (L1020Q)
Ref Sequence ENSEMBL: ENSMUSP00000154350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022696] [ENSMUST00000167242] [ENSMUST00000226448] [ENSMUST00000228346]
Predicted Effect probably damaging
Transcript: ENSMUST00000022696
AA Change: L1019Q

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022696
Gene: ENSMUSG00000022100
AA Change: L1019Q

DomainStartEndE-ValueType
IBN_N 30 96 3.52e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167242
AA Change: L1020Q

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129504
Gene: ENSMUSG00000022100
AA Change: L1020Q

DomainStartEndE-ValueType
IBN_N 30 96 3.52e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226448
AA Change: L1019Q

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226607
Predicted Effect probably damaging
Transcript: ENSMUST00000228346
AA Change: L1020Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of protein and large RNAs through the nuclear pore complexes (NPC) is an energy-dependent and regulated process. The import of proteins with a nuclear localization signal (NLS) is accomplished by recognition of one or more clusters of basic amino acids by the importin-alpha/beta complex; see MIM 600685 and MIM 602738. The small GTPase RAN (MIM 601179) plays a key role in NLS-dependent protein import. RAN-binding protein-16 is a member of the importin-beta superfamily of nuclear transport receptors.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,805 D1878G probably damaging Het
Adcy2 A G 13: 68,730,305 W405R probably damaging Het
Apc G A 18: 34,276,670 R221H probably damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Cngb1 T C 8: 95,252,107 I573V probably benign Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dmap1 G A 4: 117,676,005 T284M possibly damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif3a T C 19: 60,773,677 T487A probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam180a A T 6: 35,313,629 S140T possibly damaging Het
Fibcd1 T C 2: 31,817,264 Y327C probably damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Igfbp1 A G 11: 7,201,970 T258A probably benign Het
Isl1 T C 13: 116,308,299 T65A possibly damaging Het
Khdrbs3 T A 15: 69,049,390 D185E probably damaging Het
Klc1 C T 12: 111,806,017 R157C possibly damaging Het
Lamc3 A G 2: 31,940,702 S1484G probably benign Het
Lman1 G T 18: 65,984,273 P466Q possibly damaging Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbea C G 3: 55,934,624 E1879Q probably benign Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pigc T C 1: 161,970,670 Y74H possibly damaging Het
Plek C T 11: 16,992,887 probably null Het
Rasgrf1 C T 9: 89,991,714 A692V possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Sh3rf2 G A 18: 42,111,440 probably null Het
Sh3tc2 A G 18: 61,989,686 D506G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Sorbs1 T C 19: 40,373,571 D123G probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Tubb6 A G 18: 67,401,924 N298D probably damaging Het
Zswim4 A T 8: 84,223,748 L611Q probably damaging Het
Other mutations in Xpo7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Xpo7 APN 14 70671658 missense probably benign 0.32
IGL01066:Xpo7 APN 14 70701755 missense probably benign 0.01
IGL01610:Xpo7 APN 14 70703230 missense probably damaging 1.00
IGL01716:Xpo7 APN 14 70685555 missense probably damaging 1.00
IGL01885:Xpo7 APN 14 70666035 missense probably benign 0.03
IGL02647:Xpo7 APN 14 70685465 missense probably damaging 1.00
IGL03088:Xpo7 APN 14 70681262 missense probably benign 0.09
IGL03245:Xpo7 APN 14 70688294 missense probably damaging 1.00
BB010:Xpo7 UTSW 14 70707348 missense probably benign 0.05
BB020:Xpo7 UTSW 14 70707348 missense probably benign 0.05
G1patch:Xpo7 UTSW 14 70676813 missense probably damaging 1.00
PIT4687001:Xpo7 UTSW 14 70667149 missense probably benign 0.22
R0893:Xpo7 UTSW 14 70666097 splice site probably benign
R1222:Xpo7 UTSW 14 70667084 missense possibly damaging 0.55
R1474:Xpo7 UTSW 14 70699033 missense probably benign 0.00
R1509:Xpo7 UTSW 14 70678142 missense probably damaging 0.99
R1867:Xpo7 UTSW 14 70693991 missense probably damaging 1.00
R1898:Xpo7 UTSW 14 70695624 missense probably benign 0.20
R2105:Xpo7 UTSW 14 70690991 missense probably benign 0.02
R2369:Xpo7 UTSW 14 70687731 nonsense probably null
R2937:Xpo7 UTSW 14 70671690 missense probably damaging 0.99
R2938:Xpo7 UTSW 14 70671690 missense probably damaging 0.99
R2940:Xpo7 UTSW 14 70667137 missense probably benign 0.38
R3001:Xpo7 UTSW 14 70692645 splice site probably benign
R4436:Xpo7 UTSW 14 70669429 missense probably damaging 1.00
R4529:Xpo7 UTSW 14 70668748 missense probably damaging 1.00
R4873:Xpo7 UTSW 14 70676816 critical splice acceptor site probably null
R4875:Xpo7 UTSW 14 70676816 critical splice acceptor site probably null
R4907:Xpo7 UTSW 14 70670629 missense probably benign 0.16
R5007:Xpo7 UTSW 14 70688264 missense probably damaging 1.00
R5282:Xpo7 UTSW 14 70683731 missense probably damaging 1.00
R5346:Xpo7 UTSW 14 70683677 missense probably damaging 1.00
R5522:Xpo7 UTSW 14 70671650 nonsense probably null
R5533:Xpo7 UTSW 14 70693967 missense probably damaging 1.00
R5668:Xpo7 UTSW 14 70682846 missense possibly damaging 0.52
R6042:Xpo7 UTSW 14 70695663 missense possibly damaging 0.47
R6052:Xpo7 UTSW 14 70683719 missense possibly damaging 0.68
R6066:Xpo7 UTSW 14 70682338 missense probably null 0.99
R6085:Xpo7 UTSW 14 70696611 missense probably benign 0.38
R6180:Xpo7 UTSW 14 70682803 missense probably benign 0.14
R6291:Xpo7 UTSW 14 70704690 nonsense probably null
R6401:Xpo7 UTSW 14 70682347 missense probably damaging 1.00
R6593:Xpo7 UTSW 14 70682362 missense probably damaging 0.99
R6725:Xpo7 UTSW 14 70676813 missense probably damaging 1.00
R6938:Xpo7 UTSW 14 70666024 missense probably benign 0.00
R6996:Xpo7 UTSW 14 70669448 missense probably benign
R7020:Xpo7 UTSW 14 70666023 missense probably benign 0.00
R7053:Xpo7 UTSW 14 70684858 critical splice donor site probably null
R7061:Xpo7 UTSW 14 70671072 missense probably benign 0.04
R7095:Xpo7 UTSW 14 70704706 missense probably damaging 1.00
R7604:Xpo7 UTSW 14 70671670 missense probably damaging 1.00
R7933:Xpo7 UTSW 14 70707348 missense probably benign 0.05
R8044:Xpo7 UTSW 14 70684926 missense probably benign 0.18
R8438:Xpo7 UTSW 14 70703232 missense probably benign 0.02
R8495:Xpo7 UTSW 14 70670549 critical splice donor site probably null
R8518:Xpo7 UTSW 14 70707397 missense probably damaging 1.00
X0062:Xpo7 UTSW 14 70685528 missense probably damaging 1.00
Z1176:Xpo7 UTSW 14 70692710 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ATGCACCTCACATCTGGTC -3'
(R):5'- AGTAATCGTTAACAAGCCGCC -3'

Sequencing Primer
(F):5'- CTCACATCTGGTCAATAGAGATGC -3'
(R):5'- GCCGCCTTACAAATTACAAGTTTCTG -3'
Posted On2014-12-29