Incidental Mutation 'R2940:Haghl'
ID255158
Institutional Source Beutler Lab
Gene Symbol Haghl
Ensembl Gene ENSMUSG00000061046
Gene Namehydroxyacylglutathione hydrolase-like
Synonyms2810014I23Rik, 1500017E18Rik, C330022E15Rik
MMRRC Submission 040517-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R2940 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25779843-25785673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25785086 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 8 (V8A)
Ref Sequence ENSEMBL: ENSMUSP00000119647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002350] [ENSMUST00000077938] [ENSMUST00000095500] [ENSMUST00000133071] [ENSMUST00000134108] [ENSMUST00000138759] [ENSMUST00000140738] [ENSMUST00000145053] [ENSMUST00000150324]
Predicted Effect probably benign
Transcript: ENSMUST00000002350
SMART Domains Protein: ENSMUSP00000002350
Gene: ENSMUSG00000002280

DomainStartEndE-ValueType
Pfam:Fe_hyd_lg_C 110 406 8.5e-95 PFAM
Fe_hyd_SSU 410 466 9.56e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000077938
AA Change: V8A

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077091
Gene: ENSMUSG00000061046
AA Change: V8A

DomainStartEndE-ValueType
Lactamase_B 11 173 7.63e-25 SMART
Pfam:HAGH_C 174 270 3.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095500
SMART Domains Protein: ENSMUSP00000093155
Gene: ENSMUSG00000071202

DomainStartEndE-ValueType
Pfam:DUF4472 63 190 5.5e-23 PFAM
coiled coil region 364 408 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129917
Predicted Effect probably benign
Transcript: ENSMUST00000133071
SMART Domains Protein: ENSMUSP00000120885
Gene: ENSMUSG00000061046

DomainStartEndE-ValueType
Lactamase_B 1 125 1.34e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134108
SMART Domains Protein: ENSMUSP00000117136
Gene: ENSMUSG00000002280

DomainStartEndE-ValueType
Pfam:Fe_hyd_lg_C 110 422 4e-85 PFAM
Fe_hyd_SSU 426 482 9.56e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138100
Predicted Effect probably benign
Transcript: ENSMUST00000138759
SMART Domains Protein: ENSMUSP00000115538
Gene: ENSMUSG00000061046

DomainStartEndE-ValueType
Lactamase_B 1 125 1.34e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000140738
AA Change: V8A

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116841
Gene: ENSMUSG00000061046
AA Change: V8A

DomainStartEndE-ValueType
Lactamase_B 11 173 7.63e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143248
Predicted Effect probably benign
Transcript: ENSMUST00000145053
AA Change: V8A

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114961
Gene: ENSMUSG00000061046
AA Change: V8A

DomainStartEndE-ValueType
Pfam:Lactamase_B 7 113 3.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149645
Predicted Effect possibly damaging
Transcript: ENSMUST00000150324
AA Change: V8A

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119647
Gene: ENSMUSG00000061046
AA Change: V8A

DomainStartEndE-ValueType
Lactamase_B 11 173 7.63e-25 SMART
Pfam:HAGH_C 174 270 3.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183975
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,805 D1878G probably damaging Het
Adcy2 A G 13: 68,730,305 W405R probably damaging Het
Apc G A 18: 34,276,670 R221H probably damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Cngb1 T C 8: 95,252,107 I573V probably benign Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dmap1 G A 4: 117,676,005 T284M possibly damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif3a T C 19: 60,773,677 T487A probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam180a A T 6: 35,313,629 S140T possibly damaging Het
Fibcd1 T C 2: 31,817,264 Y327C probably damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Igfbp1 A G 11: 7,201,970 T258A probably benign Het
Isl1 T C 13: 116,308,299 T65A possibly damaging Het
Khdrbs3 T A 15: 69,049,390 D185E probably damaging Het
Klc1 C T 12: 111,806,017 R157C possibly damaging Het
Lamc3 A G 2: 31,940,702 S1484G probably benign Het
Lman1 G T 18: 65,984,273 P466Q possibly damaging Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbea C G 3: 55,934,624 E1879Q probably benign Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pigc T C 1: 161,970,670 Y74H possibly damaging Het
Plek C T 11: 16,992,887 probably null Het
Rasgrf1 C T 9: 89,991,714 A692V possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Sh3rf2 G A 18: 42,111,440 probably null Het
Sh3tc2 A G 18: 61,989,686 D506G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Sorbs1 T C 19: 40,373,571 D123G probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Tubb6 A G 18: 67,401,924 N298D probably damaging Het
Xpo7 A T 14: 70,667,136 L1020Q probably damaging Het
Xpo7 G T 14: 70,667,137 L1020I probably benign Het
Zswim4 A T 8: 84,223,748 L611Q probably damaging Het
Other mutations in Haghl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Haghl APN 17 25784265 missense probably damaging 1.00
IGL02309:Haghl APN 17 25784664 missense probably damaging 1.00
IGL02458:Haghl APN 17 25783496 splice site probably benign
IGL02480:Haghl APN 17 25783059 missense probably damaging 1.00
IGL02884:Haghl APN 17 25783098 missense possibly damaging 0.53
R2939:Haghl UTSW 17 25785086 missense possibly damaging 0.57
R4458:Haghl UTSW 17 25785020 missense probably damaging 0.99
R4850:Haghl UTSW 17 25783006 utr 3 prime probably benign
R6465:Haghl UTSW 17 25783819 missense possibly damaging 0.50
X0065:Haghl UTSW 17 25784679 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGGCAGACAATTACAATAACTGG -3'
(R):5'- CTTGGAGCTTGGAACTGAAGC -3'

Sequencing Primer
(F):5'- AGTAGTCATACTTCAGGGGATCCC -3'
(R):5'- CTGAAGCAGTTCCTCTGGAAAGTG -3'
Posted On2014-12-29