Incidental Mutation 'R2940:Lman1'
ID255163
Institutional Source Beutler Lab
Gene Symbol Lman1
Ensembl Gene ENSMUSG00000041891
Gene Namelectin, mannose-binding, 1
Synonymsgp58, F5F8D, ERGIC53, MCFD1, P58, 2610020P13Rik, MR60
MMRRC Submission 040517-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.782) question?
Stock #R2940 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location65980754-66022580 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 65984273 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 466 (P466Q)
Ref Sequence ENSEMBL: ENSMUSP00000113326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048260] [ENSMUST00000120461]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048260
AA Change: P466Q

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000040140
Gene: ENSMUSG00000041891
AA Change: P466Q

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Lectin_leg-like 52 277 2.2e-95 PFAM
low complexity region 291 307 N/A INTRINSIC
transmembrane domain 483 505 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120461
AA Change: P466Q

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113326
Gene: ENSMUSG00000041891
AA Change: P466Q

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Lectin_leg-like 52 277 2.2e-95 PFAM
low complexity region 291 307 N/A INTRINSIC
transmembrane domain 483 505 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155895
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane mannose-specific lectin that cycles between the endoplasmic reticulum, endoplasmic reticulum-Golgi intermediate compartment, and cis-Golgi, functioning as a cargo receptor for glycoprotein transport. The protein has an N-terminal signal sequence, a calcium-dependent and pH-sensitive carbohydrate recognition domain, a stalk region that functions in oligomerization, a transmembrane domain, and a short cytoplasmic domain required for organelle targeting. Allelic variants of this gene are associated with the autosomal recessive disorder combined factor V-factor VIII deficiency. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit strain dependent postnatal lethality and slightly dilated endoplasmic reticulum in hepatocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,805 D1878G probably damaging Het
Adcy2 A G 13: 68,730,305 W405R probably damaging Het
Apc G A 18: 34,276,670 R221H probably damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Cngb1 T C 8: 95,252,107 I573V probably benign Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dmap1 G A 4: 117,676,005 T284M possibly damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif3a T C 19: 60,773,677 T487A probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam180a A T 6: 35,313,629 S140T possibly damaging Het
Fibcd1 T C 2: 31,817,264 Y327C probably damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Igfbp1 A G 11: 7,201,970 T258A probably benign Het
Isl1 T C 13: 116,308,299 T65A possibly damaging Het
Khdrbs3 T A 15: 69,049,390 D185E probably damaging Het
Klc1 C T 12: 111,806,017 R157C possibly damaging Het
Lamc3 A G 2: 31,940,702 S1484G probably benign Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbea C G 3: 55,934,624 E1879Q probably benign Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pigc T C 1: 161,970,670 Y74H possibly damaging Het
Plek C T 11: 16,992,887 probably null Het
Rasgrf1 C T 9: 89,991,714 A692V possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Sh3rf2 G A 18: 42,111,440 probably null Het
Sh3tc2 A G 18: 61,989,686 D506G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Sorbs1 T C 19: 40,373,571 D123G probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Tubb6 A G 18: 67,401,924 N298D probably damaging Het
Xpo7 A T 14: 70,667,136 L1020Q probably damaging Het
Xpo7 G T 14: 70,667,137 L1020I probably benign Het
Zswim4 A T 8: 84,223,748 L611Q probably damaging Het
Other mutations in Lman1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00644:Lman1 APN 18 65997622 nonsense probably null
IGL01098:Lman1 APN 18 65991640 missense probably damaging 1.00
IGL01347:Lman1 APN 18 65991610 missense probably damaging 0.99
IGL01701:Lman1 APN 18 65994850 missense possibly damaging 0.91
IGL03331:Lman1 APN 18 65993204 missense probably benign 0.00
R1101:Lman1 UTSW 18 65987898 missense probably benign 0.00
R1434:Lman1 UTSW 18 65993073 critical splice donor site probably null
R1785:Lman1 UTSW 18 65991582 missense probably damaging 0.99
R1786:Lman1 UTSW 18 65991582 missense probably damaging 0.99
R1794:Lman1 UTSW 18 65991684 missense probably benign 0.21
R2038:Lman1 UTSW 18 65998610 missense probably benign 0.30
R2060:Lman1 UTSW 18 65998352 intron probably benign
R4125:Lman1 UTSW 18 65987861 missense possibly damaging 0.66
R4471:Lman1 UTSW 18 65991726 unclassified probably benign
R4751:Lman1 UTSW 18 65998434 missense probably benign 0.06
R7021:Lman1 UTSW 18 65991643 missense probably benign 0.02
R7199:Lman1 UTSW 18 65994865 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTTGTAGTGAACTGTCTAC -3'
(R):5'- GCCAGTTGTTCTGTGAAAGCG -3'

Sequencing Primer
(F):5'- GTGAACTGTCTACATTAGTGAGAGC -3'
(R):5'- GCGGAAGAATTTTTAAAAGATTGCAG -3'
Posted On2014-12-29