Incidental Mutation 'R2940:Tubb6'
ID255164
Institutional Source Beutler Lab
Gene Symbol Tubb6
Ensembl Gene ENSMUSG00000001473
Gene Nametubulin, beta 6 class V
Synonyms
MMRRC Submission 040517-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2940 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location67390717-67402748 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67401924 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 298 (N298D)
Ref Sequence ENSEMBL: ENSMUSP00000001513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001513] [ENSMUST00000025408]
Predicted Effect probably damaging
Transcript: ENSMUST00000001513
AA Change: N298D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000001513
Gene: ENSMUSG00000001473
AA Change: N298D

DomainStartEndE-ValueType
Tubulin 47 244 6.2e-66 SMART
Tubulin_C 246 383 3.57e-48 SMART
low complexity region 432 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025408
SMART Domains Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527

DomainStartEndE-ValueType
low complexity region 95 121 N/A INTRINSIC
Pfam:FtsH_ext 144 241 8.8e-12 PFAM
transmembrane domain 251 270 N/A INTRINSIC
low complexity region 271 286 N/A INTRINSIC
AAA 339 478 1.37e-23 SMART
Pfam:Peptidase_M41 540 743 4e-77 PFAM
low complexity region 780 794 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,805 D1878G probably damaging Het
Adcy2 A G 13: 68,730,305 W405R probably damaging Het
Apc G A 18: 34,276,670 R221H probably damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Cngb1 T C 8: 95,252,107 I573V probably benign Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dmap1 G A 4: 117,676,005 T284M possibly damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif3a T C 19: 60,773,677 T487A probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam180a A T 6: 35,313,629 S140T possibly damaging Het
Fibcd1 T C 2: 31,817,264 Y327C probably damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Igfbp1 A G 11: 7,201,970 T258A probably benign Het
Isl1 T C 13: 116,308,299 T65A possibly damaging Het
Khdrbs3 T A 15: 69,049,390 D185E probably damaging Het
Klc1 C T 12: 111,806,017 R157C possibly damaging Het
Lamc3 A G 2: 31,940,702 S1484G probably benign Het
Lman1 G T 18: 65,984,273 P466Q possibly damaging Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbea C G 3: 55,934,624 E1879Q probably benign Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pigc T C 1: 161,970,670 Y74H possibly damaging Het
Plek C T 11: 16,992,887 probably null Het
Rasgrf1 C T 9: 89,991,714 A692V possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Sh3rf2 G A 18: 42,111,440 probably null Het
Sh3tc2 A G 18: 61,989,686 D506G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Sorbs1 T C 19: 40,373,571 D123G probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Xpo7 A T 14: 70,667,136 L1020Q probably damaging Het
Xpo7 G T 14: 70,667,137 L1020I probably benign Het
Zswim4 A T 8: 84,223,748 L611Q probably damaging Het
Other mutations in Tubb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Tubb6 APN 18 67402273 missense probably damaging 1.00
IGL02634:Tubb6 APN 18 67402296 missense probably damaging 1.00
R1926:Tubb6 UTSW 18 67401321 splice site probably null
R3739:Tubb6 UTSW 18 67402051 missense probably damaging 1.00
R3784:Tubb6 UTSW 18 67392993 missense possibly damaging 0.87
R4660:Tubb6 UTSW 18 67401946 missense probably damaging 1.00
R4880:Tubb6 UTSW 18 67401316 missense possibly damaging 0.90
R6351:Tubb6 UTSW 18 67401388 missense probably damaging 1.00
R7028:Tubb6 UTSW 18 67401911 missense probably benign 0.00
R7863:Tubb6 UTSW 18 67401720 missense probably damaging 1.00
R8777:Tubb6 UTSW 18 67401528 missense probably damaging 0.98
R8777-TAIL:Tubb6 UTSW 18 67401528 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACATCACTGCGTTTCCCTGG -3'
(R):5'- TATTGCCAATGAAGGTGGAGGC -3'

Sequencing Primer
(F):5'- GTTTCCCTGGCCAACTCAACG -3'
(R):5'- TGGAGGCCATCTTCAGGC -3'
Posted On2014-12-29