Incidental Mutation 'R2940:Smc1a'
ID255169
Institutional Source Beutler Lab
Gene Symbol Smc1a
Ensembl Gene ENSMUSG00000041133
Gene Namestructural maintenance of chromosomes 1A
SynonymsSmc1alpha, SB1.8, 5830426I24Rik, Smc1l1, Smc1, SMCB
MMRRC Submission 040517-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R2940 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location152016428-152062694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 152033699 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 516 (Y516N)
Ref Sequence ENSEMBL: ENSMUSP00000044645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045312] [ENSMUST00000145518]
PDB Structure
SMC hinge heterodimer (Mouse) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000045312
AA Change: Y516N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044645
Gene: ENSMUSG00000041133
AA Change: Y516N

DomainStartEndE-ValueType
Pfam:AAA_29 4 57 6.7e-10 PFAM
Pfam:AAA_23 7 299 8.3e-15 PFAM
low complexity region 347 361 N/A INTRINSIC
SMC_hinge 513 629 5.39e-34 SMART
low complexity region 673 687 N/A INTRINSIC
low complexity region 951 967 N/A INTRINSIC
low complexity region 1045 1061 N/A INTRINSIC
PDB:1W1W|D 1062 1223 2e-40 PDB
Blast:AAA 1070 1222 3e-25 BLAST
SCOP:d1e69a_ 1119 1208 5e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135172
Predicted Effect probably benign
Transcript: ENSMUST00000145518
SMART Domains Protein: ENSMUSP00000138113
Gene: ENSMUSG00000041133

DomainStartEndE-ValueType
Pfam:SMC_N 3 43 6.1e-14 PFAM
Meta Mutation Damage Score 0.7968 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proper cohesion of sister chromatids is a prerequisite for the correct segregation of chromosomes during cell division. The cohesin multiprotein complex is required for sister chromatid cohesion. This complex is composed partly of two structural maintenance of chromosomes (SMC) proteins, SMC3 and either SMC1B or the protein encoded by this gene. Most of the cohesin complexes dissociate from the chromosomes before mitosis, although those complexes at the kinetochore remain. Therefore, the encoded protein is thought to be an important part of functional kinetochores. In addition, this protein interacts with BRCA1 and is phosphorylated by ATM, indicating a potential role for this protein in DNA repair. This gene, which belongs to the SMC gene family, is located in an area of the X-chromosome that escapes X inactivation. Mutations in this gene result in Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a disruption in this gene display increased chromosomal instability, decreased cell survival, and defective S-phase checkpoint after ionizing radiation exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,805 D1878G probably damaging Het
Adcy2 A G 13: 68,730,305 W405R probably damaging Het
Apc G A 18: 34,276,670 R221H probably damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Cngb1 T C 8: 95,252,107 I573V probably benign Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dmap1 G A 4: 117,676,005 T284M possibly damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif3a T C 19: 60,773,677 T487A probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam180a A T 6: 35,313,629 S140T possibly damaging Het
Fibcd1 T C 2: 31,817,264 Y327C probably damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Igfbp1 A G 11: 7,201,970 T258A probably benign Het
Isl1 T C 13: 116,308,299 T65A possibly damaging Het
Khdrbs3 T A 15: 69,049,390 D185E probably damaging Het
Klc1 C T 12: 111,806,017 R157C possibly damaging Het
Lamc3 A G 2: 31,940,702 S1484G probably benign Het
Lman1 G T 18: 65,984,273 P466Q possibly damaging Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbea C G 3: 55,934,624 E1879Q probably benign Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pigc T C 1: 161,970,670 Y74H possibly damaging Het
Plek C T 11: 16,992,887 probably null Het
Rasgrf1 C T 9: 89,991,714 A692V possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Sh3rf2 G A 18: 42,111,440 probably null Het
Sh3tc2 A G 18: 61,989,686 D506G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Sorbs1 T C 19: 40,373,571 D123G probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Tubb6 A G 18: 67,401,924 N298D probably damaging Het
Xpo7 A T 14: 70,667,136 L1020Q probably damaging Het
Xpo7 G T 14: 70,667,137 L1020I probably benign Het
Zswim4 A T 8: 84,223,748 L611Q probably damaging Het
Other mutations in Smc1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Smc1a APN X 152036129 missense probably damaging 1.00
IGL02385:Smc1a APN X 152037659 missense possibly damaging 0.67
R2421:Smc1a UTSW X 152047975 splice site probably benign
R2422:Smc1a UTSW X 152047975 splice site probably benign
R2939:Smc1a UTSW X 152033699 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTCTTCCATCTTTTAACATGTTTAT -3'
(R):5'- GGCAAGAAGGTCTCAGGC -3'

Sequencing Primer
(F):5'- GCCAAACTTCTATCTTTGGAAGGAGC -3'
(R):5'- AAGAAGGTCTCAGGCTCTCC -3'
Posted On2014-12-29