Mutagenetix > Incidental Mutation

Incidental Mutation 'R2941:Tspan32'

255177

Institutional Source

Beutler Lab

Gene Symbol

Tspan32

Ensembl Gene

ENSMUSG00000000244

Gene Name

tetraspanin 32

Synonyms

Tspan32, Art-1, Tssc6, Phemx, D7Wsu37e

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2941 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

142558644-142573223 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 142568729 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 103 (V103M)

Ref Sequence

ENSEMBL: ENSMUSP00000101544 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009396] [ENSMUST00000075172] [ENSMUST00000082008] [ENSMUST00000105923] [ENSMUST00000105924] [ENSMUST00000105925] [ENSMUST00000143512] [ENSMUST00000207211] [ENSMUST00000145212]

AlphaFold

Q9JHH2

Predicted Effect

probably damaging
Transcript: ENSMUST00000009396
AA Change: V130M

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000009396
Gene: ENSMUSG00000000244
AA Change: V130M

Domain	Start	End	E-Value	Type
Pfam:Tetraspannin	9	223	3.2e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000075172
AA Change: V103M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000074667
Gene: ENSMUSG00000000244
AA Change: V103M

Domain	Start	End	E-Value	Type
Pfam:Tetraspannin	1	198	3.1e-13	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000082008
AA Change: V103M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000080668
Gene: ENSMUSG00000000244
AA Change: V103M

Domain	Start	End	E-Value	Type
Pfam:Tetraspannin	1	146	7.1e-13	PFAM
transmembrane domain	155	174	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105923

SMART Domains

Protein: ENSMUSP00000101543
Gene: ENSMUSG00000000244

Domain	Start	End	E-Value	Type
transmembrane domain	33	55	N/A	INTRINSIC
transmembrane domain	62	84	N/A	INTRINSIC
transmembrane domain	121	140	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000105924
AA Change: V103M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000101544
Gene: ENSMUSG00000000244
AA Change: V103M

Domain	Start	End	E-Value	Type
Pfam:Tetraspannin	1	148	1.8e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000105925

SMART Domains

Protein: ENSMUSP00000101545
Gene: ENSMUSG00000000244

Domain	Start	End	E-Value	Type
transmembrane domain	33	55	N/A	INTRINSIC
transmembrane domain	65	87	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000143512
AA Change: V75M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000115344
Gene: ENSMUSG00000000244
AA Change: V75M

Domain	Start	End	E-Value	Type
transmembrane domain	29	51	N/A	INTRINSIC
transmembrane domain	146	168	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154264

Predicted Effect

probably benign
Transcript: ENSMUST00000207211

Predicted Effect

probably benign
Transcript: ENSMUST00000145212

SMART Domains

Protein: ENSMUSP00000116212
Gene: ENSMUSG00000000244

Domain	Start	End	E-Value	Type
transmembrane domain	33	55	N/A	INTRINSIC
transmembrane domain	62	84	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is a member of the tetraspanin superfamily, is one of several tumor-suppressing subtransferable fragments located in the imprinted gene domain of chromosome 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian and breast cancers. This gene is located among several imprinted genes; however, this gene, as well as the tumor-suppressing subchromosomal transferable fragment 4, escapes imprinting. This gene may play a role in malignancies and diseases that involve this region, and it is also involved in hematopoietic cell function. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap null mutation exhibit normal hematopoiesis, hemolytic and granulopoitic responses. B cells exhibit normal proliferative responses while T cells demonstrate enhanced proliferation upon T cell receptor stimulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 15 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afg1l	G	T	10: 42,354,291 (GRCm39)		probably null	Het
Ankrd60	A	G	2: 173,410,674 (GRCm39)	L282P	probably damaging	Het
Avl9	T	C	6: 56,730,870 (GRCm39)	V598A	probably benign	Het
Dgkb	T	A	12: 38,654,122 (GRCm39)	M747K	possibly damaging	Het
Elmo1	C	G	13: 20,784,382 (GRCm39)	Y646*	probably null	Het
Fgr	A	C	4: 132,725,734 (GRCm39)	Y381S	probably benign	Het
Ggnbp2	T	C	11: 84,732,407 (GRCm39)	I271V	probably damaging	Het
Itprid2	T	A	2: 79,466,000 (GRCm39)	D39E	probably benign	Het
Ltbp1	A	G	17: 75,486,088 (GRCm39)	T38A	probably damaging	Het
Or8b52	A	G	9: 38,576,322 (GRCm39)	S273P	probably damaging	Het
Setbp1	C	A	18: 78,901,412 (GRCm39)	V752L	probably damaging	Het
Slc8a3	C	A	12: 81,361,953 (GRCm39)	G289W	probably damaging	Het
Slu7	G	T	11: 43,335,584 (GRCm39)	R440L	probably benign	Het
Tacr1	T	A	6: 82,380,715 (GRCm39)	I42N	probably damaging	Het
Tyk2	A	G	9: 21,022,415 (GRCm39)	S805P	probably benign	Het

Other mutations in Tspan32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01466:Tspan32	APN	7	142,568,691 (GRCm39)	intron	probably benign
IGL02122:Tspan32	APN	7	142,569,372 (GRCm39)	missense	probably damaging	0.99
IGL02830:Tspan32	APN	7	142,571,329 (GRCm39)	missense	possibly damaging	0.93
theron	UTSW	7	142,571,328 (GRCm39)	missense	probably benign	0.37
R0594:Tspan32	UTSW	7	142,569,347 (GRCm39)	missense	probably damaging	0.98
R1162:Tspan32	UTSW	7	142,560,735 (GRCm39)	missense	probably damaging	1.00
R1317:Tspan32	UTSW	7	142,571,328 (GRCm39)	missense	probably benign	0.37
R1513:Tspan32	UTSW	7	142,558,886 (GRCm39)	missense	probably null	0.05
R3953:Tspan32	UTSW	7	142,560,735 (GRCm39)	missense	probably damaging	1.00
R3955:Tspan32	UTSW	7	142,560,735 (GRCm39)	missense	probably damaging	1.00
R3957:Tspan32	UTSW	7	142,560,735 (GRCm39)	missense	probably damaging	1.00
R5021:Tspan32	UTSW	7	142,568,715 (GRCm39)	missense	probably damaging	1.00
R5849:Tspan32	UTSW	7	142,569,324 (GRCm39)	missense	probably damaging	1.00
R6429:Tspan32	UTSW	7	142,572,479 (GRCm39)	missense	possibly damaging	0.59
R7205:Tspan32	UTSW	7	142,558,863 (GRCm39)	missense	possibly damaging	0.66
R7756:Tspan32	UTSW	7	142,570,959 (GRCm39)	missense	probably benign	0.32
R8218:Tspan32	UTSW	7	142,564,832 (GRCm39)	missense	probably benign	0.03
R8412:Tspan32	UTSW	7	142,559,695 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TACCCAGAAGCTACCACTGAGG -3'
(R):5'- TTCTGAGACCTCCTCTTGAAGC -3'

Sequencing Primer
(F):5'- GGTAGCTAAGTTCTGCTGACCTC -3'
(R):5'- CTCTTGAAGCCTTGCCAGGATG -3'

Posted On

2014-12-29